ID: 1174893289

View in Genome Browser
Species Human (GRCh38)
Location 20:54421103-54421125
Sequence AAAATGGAAGCTCCTCAGGC CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1174893289_1174893292 0 Left 1174893289 20:54421103-54421125 CCGGCCTGAGGAGCTTCCATTTT No data
Right 1174893292 20:54421126-54421148 CTGTAGCAAAAATACGTAGCTGG No data
1174893289_1174893293 1 Left 1174893289 20:54421103-54421125 CCGGCCTGAGGAGCTTCCATTTT No data
Right 1174893293 20:54421127-54421149 TGTAGCAAAAATACGTAGCTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1174893289 Original CRISPR AAAATGGAAGCTCCTCAGGC CGG (reversed) Intergenic
No off target data available for this crispr