ID: 1174893293

View in Genome Browser
Species Human (GRCh38)
Location 20:54421127-54421149
Sequence TGTAGCAAAAATACGTAGCT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1174893289_1174893293 1 Left 1174893289 20:54421103-54421125 CCGGCCTGAGGAGCTTCCATTTT No data
Right 1174893293 20:54421127-54421149 TGTAGCAAAAATACGTAGCTGGG No data
1174893290_1174893293 -3 Left 1174893290 20:54421107-54421129 CCTGAGGAGCTTCCATTTTCTGT No data
Right 1174893293 20:54421127-54421149 TGTAGCAAAAATACGTAGCTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1174893293 Original CRISPR TGTAGCAAAAATACGTAGCT GGG Intergenic
No off target data available for this crispr