ID: 1174898048

View in Genome Browser
Species Human (GRCh38)
Location 20:54471448-54471470
Sequence GAATCACTCATTGTTGGGAC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1174898044_1174898048 23 Left 1174898044 20:54471402-54471424 CCTGTGGTGAGAGTGACTGGGGC No data
Right 1174898048 20:54471448-54471470 GAATCACTCATTGTTGGGACTGG No data
1174898040_1174898048 27 Left 1174898040 20:54471398-54471420 CCAGCCTGTGGTGAGAGTGACTG No data
Right 1174898048 20:54471448-54471470 GAATCACTCATTGTTGGGACTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1174898048 Original CRISPR GAATCACTCATTGTTGGGAC TGG Intergenic
No off target data available for this crispr