ID: 1174898672

View in Genome Browser
Species Human (GRCh38)
Location 20:54476045-54476067
Sequence CAAGAGAGAGACAATCGAAC CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 158
Summary {0: 1, 1: 0, 2: 1, 3: 5, 4: 151}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1174898672_1174898676 -1 Left 1174898672 20:54476045-54476067 CCGGTTCGATTGTCTCTCTCTTG 0: 1
1: 0
2: 1
3: 5
4: 151
Right 1174898676 20:54476067-54476089 GAGCCAGCATCCCTGGAGGGTGG 0: 1
1: 0
2: 3
3: 37
4: 334
1174898672_1174898678 3 Left 1174898672 20:54476045-54476067 CCGGTTCGATTGTCTCTCTCTTG 0: 1
1: 0
2: 1
3: 5
4: 151
Right 1174898678 20:54476071-54476093 CAGCATCCCTGGAGGGTGGACGG 0: 1
1: 0
2: 3
3: 32
4: 380
1174898672_1174898674 -5 Left 1174898672 20:54476045-54476067 CCGGTTCGATTGTCTCTCTCTTG 0: 1
1: 0
2: 1
3: 5
4: 151
Right 1174898674 20:54476063-54476085 TCTTGAGCCAGCATCCCTGGAGG 0: 1
1: 0
2: 1
3: 18
4: 281
1174898672_1174898681 14 Left 1174898672 20:54476045-54476067 CCGGTTCGATTGTCTCTCTCTTG 0: 1
1: 0
2: 1
3: 5
4: 151
Right 1174898681 20:54476082-54476104 GAGGGTGGACGGAGAGTCCCCGG 0: 1
1: 0
2: 0
3: 22
4: 275
1174898672_1174898673 -8 Left 1174898672 20:54476045-54476067 CCGGTTCGATTGTCTCTCTCTTG 0: 1
1: 0
2: 1
3: 5
4: 151
Right 1174898673 20:54476060-54476082 CTCTCTTGAGCCAGCATCCCTGG 0: 1
1: 0
2: 1
3: 19
4: 279
1174898672_1174898675 -4 Left 1174898672 20:54476045-54476067 CCGGTTCGATTGTCTCTCTCTTG 0: 1
1: 0
2: 1
3: 5
4: 151
Right 1174898675 20:54476064-54476086 CTTGAGCCAGCATCCCTGGAGGG 0: 1
1: 0
2: 2
3: 43
4: 705
1174898672_1174898682 25 Left 1174898672 20:54476045-54476067 CCGGTTCGATTGTCTCTCTCTTG 0: 1
1: 0
2: 1
3: 5
4: 151
Right 1174898682 20:54476093-54476115 GAGAGTCCCCGGCCGCGCGCCGG 0: 1
1: 0
2: 1
3: 8
4: 97

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1174898672 Original CRISPR CAAGAGAGAGACAATCGAAC CGG (reversed) Intronic