ID: 1174898677

View in Genome Browser
Species Human (GRCh38)
Location 20:54476070-54476092
Sequence CGTCCACCCTCCAGGGATGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 244
Summary {0: 1, 1: 0, 2: 0, 3: 9, 4: 234}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1174898677_1174898688 15 Left 1174898677 20:54476070-54476092 CCAGCATCCCTGGAGGGTGGACG 0: 1
1: 0
2: 0
3: 9
4: 234
Right 1174898688 20:54476108-54476130 CGCGCCGGAGAATTGCGCGGTGG 0: 1
1: 0
2: 0
3: 1
4: 28
1174898677_1174898682 0 Left 1174898677 20:54476070-54476092 CCAGCATCCCTGGAGGGTGGACG 0: 1
1: 0
2: 0
3: 9
4: 234
Right 1174898682 20:54476093-54476115 GAGAGTCCCCGGCCGCGCGCCGG 0: 1
1: 0
2: 1
3: 8
4: 97
1174898677_1174898687 12 Left 1174898677 20:54476070-54476092 CCAGCATCCCTGGAGGGTGGACG 0: 1
1: 0
2: 0
3: 9
4: 234
Right 1174898687 20:54476105-54476127 CCGCGCGCCGGAGAATTGCGCGG 0: 1
1: 0
2: 0
3: 2
4: 16

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1174898677 Original CRISPR CGTCCACCCTCCAGGGATGC TGG (reversed) Intronic