ID: 1174898679

View in Genome Browser
Species Human (GRCh38)
Location 20:54476077-54476099
Sequence GACTCTCCGTCCACCCTCCA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 121
Summary {0: 1, 1: 0, 2: 1, 3: 7, 4: 112}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1174898679_1174898688 8 Left 1174898679 20:54476077-54476099 CCCTGGAGGGTGGACGGAGAGTC 0: 1
1: 0
2: 1
3: 7
4: 112
Right 1174898688 20:54476108-54476130 CGCGCCGGAGAATTGCGCGGTGG 0: 1
1: 0
2: 0
3: 1
4: 28
1174898679_1174898687 5 Left 1174898679 20:54476077-54476099 CCCTGGAGGGTGGACGGAGAGTC 0: 1
1: 0
2: 1
3: 7
4: 112
Right 1174898687 20:54476105-54476127 CCGCGCGCCGGAGAATTGCGCGG 0: 1
1: 0
2: 0
3: 2
4: 16
1174898679_1174898682 -7 Left 1174898679 20:54476077-54476099 CCCTGGAGGGTGGACGGAGAGTC 0: 1
1: 0
2: 1
3: 7
4: 112
Right 1174898682 20:54476093-54476115 GAGAGTCCCCGGCCGCGCGCCGG 0: 1
1: 0
2: 1
3: 8
4: 97

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1174898679 Original CRISPR GACTCTCCGTCCACCCTCCA GGG (reversed) Intronic