ID: 1174898682

View in Genome Browser
Species Human (GRCh38)
Location 20:54476093-54476115
Sequence GAGAGTCCCCGGCCGCGCGC CGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 107
Summary {0: 1, 1: 0, 2: 1, 3: 8, 4: 97}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1174898677_1174898682 0 Left 1174898677 20:54476070-54476092 CCAGCATCCCTGGAGGGTGGACG 0: 1
1: 0
2: 0
3: 9
4: 234
Right 1174898682 20:54476093-54476115 GAGAGTCCCCGGCCGCGCGCCGG 0: 1
1: 0
2: 1
3: 8
4: 97
1174898680_1174898682 -8 Left 1174898680 20:54476078-54476100 CCTGGAGGGTGGACGGAGAGTCC 0: 1
1: 0
2: 0
3: 15
4: 142
Right 1174898682 20:54476093-54476115 GAGAGTCCCCGGCCGCGCGCCGG 0: 1
1: 0
2: 1
3: 8
4: 97
1174898679_1174898682 -7 Left 1174898679 20:54476077-54476099 CCCTGGAGGGTGGACGGAGAGTC 0: 1
1: 0
2: 1
3: 7
4: 112
Right 1174898682 20:54476093-54476115 GAGAGTCCCCGGCCGCGCGCCGG 0: 1
1: 0
2: 1
3: 8
4: 97
1174898672_1174898682 25 Left 1174898672 20:54476045-54476067 CCGGTTCGATTGTCTCTCTCTTG 0: 1
1: 0
2: 1
3: 5
4: 151
Right 1174898682 20:54476093-54476115 GAGAGTCCCCGGCCGCGCGCCGG 0: 1
1: 0
2: 1
3: 8
4: 97

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1174898682 Original CRISPR GAGAGTCCCCGGCCGCGCGC CGG Intronic