ID: 1174898682

View in Genome Browser
Species Human (GRCh38)
Location 20:54476093-54476115
Sequence GAGAGTCCCCGGCCGCGCGC CGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 107
Summary {0: 1, 1: 0, 2: 1, 3: 8, 4: 97}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1174898679_1174898682 -7 Left 1174898679 20:54476077-54476099 CCCTGGAGGGTGGACGGAGAGTC 0: 1
1: 0
2: 1
3: 7
4: 112
Right 1174898682 20:54476093-54476115 GAGAGTCCCCGGCCGCGCGCCGG 0: 1
1: 0
2: 1
3: 8
4: 97
1174898672_1174898682 25 Left 1174898672 20:54476045-54476067 CCGGTTCGATTGTCTCTCTCTTG 0: 1
1: 0
2: 1
3: 5
4: 151
Right 1174898682 20:54476093-54476115 GAGAGTCCCCGGCCGCGCGCCGG 0: 1
1: 0
2: 1
3: 8
4: 97
1174898680_1174898682 -8 Left 1174898680 20:54476078-54476100 CCTGGAGGGTGGACGGAGAGTCC 0: 1
1: 0
2: 0
3: 15
4: 142
Right 1174898682 20:54476093-54476115 GAGAGTCCCCGGCCGCGCGCCGG 0: 1
1: 0
2: 1
3: 8
4: 97
1174898677_1174898682 0 Left 1174898677 20:54476070-54476092 CCAGCATCCCTGGAGGGTGGACG 0: 1
1: 0
2: 0
3: 9
4: 234
Right 1174898682 20:54476093-54476115 GAGAGTCCCCGGCCGCGCGCCGG 0: 1
1: 0
2: 1
3: 8
4: 97

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1174898682 Original CRISPR GAGAGTCCCCGGCCGCGCGC CGG Intronic
900582564 1:3416332-3416354 GAGAGACCCCAGCCGCGTGATGG + Intronic
901526048 1:9823994-9824016 GAGGGTACCCGGCCGGGGGCGGG + Exonic
903069053 1:20717742-20717764 GGGAGTCCCCGGCGGGGCGGGGG - Exonic
905461182 1:38123958-38123980 GAGGGTCCCAGCCCGCACGCGGG + Intergenic
907567775 1:55452321-55452343 GAGAGACACCGGCTGGGCGCAGG - Intergenic
920674607 1:208030403-208030425 GAGCATCCCCGGCCCAGCGCTGG - Intronic
924561148 1:245156790-245156812 GAGAGCCCCCGGCGGCGCTGGGG + Intronic
1064443044 10:15370852-15370874 GAGGGTCCCGGGCCGCGTGGTGG - Intronic
1065025333 10:21534923-21534945 GAGGGTCCGCGGCGGGGCGCGGG + Intronic
1065712810 10:28533446-28533468 GAGAGTCGCCGAGGGCGCGCCGG + Exonic
1070087032 10:73247408-73247430 CACAGTCCCCGGCCGCGCGCAGG + Exonic
1073136512 10:101223404-101223426 GAGGTCCCCGGGCCGCGCGCAGG + Intergenic
1073325863 10:102643786-102643808 GAGAAGCCCCGGCGGCGCTCCGG - Intergenic
1075885566 10:125896449-125896471 CAGTGTCCCCGGCGACGCGCGGG + Intergenic
1077661633 11:4073809-4073831 GAGAGTCCCCTGCTGCCCCCAGG - Intronic
1084019477 11:66409224-66409246 GGGACTCCCCGGCCCGGCGCGGG - Intergenic
1084524214 11:69685926-69685948 CCGAGTCCCCGGCCCCGCGCGGG + Intergenic
1085076762 11:73598278-73598300 GGGAGGCGCAGGCCGCGCGCGGG - Intergenic
1085396874 11:76210839-76210861 GGGTGGCCCCGGCCGCGCGCGGG + Intergenic
1092861902 12:12725649-12725671 GAGGGGCCCCGGGCGGGCGCGGG - Intergenic
1095584533 12:43835951-43835973 CAAAGTCCGCGGCCGCGGGCCGG - Intronic
1097246419 12:57610129-57610151 GCAACTCCCCGGACGCGCGCAGG + Intergenic
1101999762 12:109549998-109550020 GAGAGTCCCTGGCCGGGCCGGGG + Intergenic
1105578903 13:21675547-21675569 GTGAGGCCGCGGCGGCGCGCGGG - Intronic
1106157228 13:27170962-27170984 CCGAGTCCCCGACCCCGCGCTGG - Intronic
1112771521 13:102799427-102799449 GCGCCTCGCCGGCCGCGCGCTGG + Exonic
1113082875 13:106535731-106535753 GCGGCTCCGCGGCCGCGCGCTGG + Intergenic
1118350930 14:64972149-64972171 CAGCGTCCCCGGGCGGGCGCGGG - Exonic
1123060494 14:105592196-105592218 GAGGGTCCCCGACCACCCGCAGG + Intergenic
1123084972 14:105713167-105713189 GAGGGTCCCCGACCACCCGCAGG + Intergenic
1124159300 15:27254285-27254307 GAGAGTCCCTGGCCTCTCCCTGG - Intronic
1128325197 15:66719601-66719623 AAGAGTCCCAGGCCCAGCGCTGG - Intronic
1129427577 15:75475288-75475310 GACAGTAACCGGCCGGGCGCAGG + Intronic
1132273208 15:100544502-100544524 GAGGGTCCTCGTCCCCGCGCAGG - Intronic
1132464828 16:72589-72611 CCGAGTCCCCGCCCGCCCGCCGG + Exonic
1132934924 16:2475304-2475326 GGGGATCCCCGGCCACGCGCGGG + Intronic
1134644925 16:15858260-15858282 GCGGGTCCCCGGCCTGGCGCGGG - Intergenic
1137988846 16:53131639-53131661 GGGAGGCCCCGACCTCGCGCGGG - Intronic
1139528489 16:67530266-67530288 TACATTCCCTGGCCGCGCGCTGG - Intronic
1141566699 16:84907215-84907237 GAGAGACCCCGGCTCCGCCCTGG + Exonic
1141861305 16:86718316-86718338 GAGAGTCTCAGGCCCCGCCCTGG + Intergenic
1146581145 17:34039971-34039993 GAGAGGCCCCGGCTCCGCCCCGG - Intronic
1147436199 17:40417717-40417739 GAGATGCCCGGGCCGCGCGGAGG + Intronic
1147743758 17:42683001-42683023 GAGAGCCAGCGGGCGCGCGCCGG - Intronic
1150108620 17:62479175-62479197 GAGAGGCCCCGGCTCCGCCCCGG + Exonic
1152633647 17:81421644-81421666 GAGAGCCCCCAGCCGTGTGCAGG + Intronic
1152663174 17:81552354-81552376 GAGAAGCCCCGGCCGCGCGGCGG + Exonic
1153911274 18:9708329-9708351 GAGAGACGCCGGCGGGGCGCGGG + Exonic
1154502687 18:15004515-15004537 GGGAGTCCCCCGCCGCCCGCGGG - Intergenic
1157278987 18:46333815-46333837 GCGGGTCCCTGGCCGCCCGCGGG - Intronic
1160455320 18:78995217-78995239 GAGGGTCCCCCGCTGCCCGCGGG + Exonic
1160887009 19:1354848-1354870 CGGCGTCCACGGCCGCGCGCCGG - Intronic
1160909902 19:1469567-1469589 GACAGTCTCCGGCCGGGCGGCGG - Exonic
1161731534 19:5963969-5963991 GAGAGTCCCCTGCTGCCCCCTGG + Intronic
1162435345 19:10654668-10654690 GAGAGTTAACGGCCGAGCGCGGG - Intronic
1162733127 19:12730925-12730947 GAGAGTCCCAGGCCATGGGCAGG + Exonic
1163698456 19:18775534-18775556 CAGAGTCCCCAGCTGCGGGCAGG + Intronic
1165311304 19:35030714-35030736 GAATGTCCCCGGGAGCGCGCGGG - Intronic
928186661 2:29116009-29116031 GAGAGTCCCCGCACGCGCAGTGG + Intronic
931348646 2:61470214-61470236 GAGAGGCCTCGGCAGCACGCTGG + Intronic
931869643 2:66444659-66444681 GTGAGGCCCGGGCCGCCCGCGGG - Intronic
932591522 2:73070794-73070816 GCCAGTCCCCGGCGGCGCGGGGG + Intronic
935237562 2:101151330-101151352 GAGAGGCGACGGCGGCGCGCGGG + Intronic
938501856 2:131834685-131834707 GGGAGTCCCCCGCCGCCCGCGGG - Intergenic
941367041 2:164621614-164621636 GAGCGCCCCGGGCCACGCGCGGG - Exonic
945225713 2:207529845-207529867 GAGCGGCCCCGCCCCCGCGCTGG - Intronic
947156205 2:227164685-227164707 GAGGGTCCCCGGACTCGCCCAGG + Exonic
948923207 2:241076746-241076768 GAGAGTCCAGGGCCGGGCGCGGG + Intronic
1174898682 20:54476093-54476115 GAGAGTCCCCGGCCGCGCGCCGG + Intronic
1175859577 20:62143171-62143193 CCGCGTCCCCGGCCCCGCGCAGG + Intronic
1176550440 21:8218704-8218726 GCGCGTGCCCCGCCGCGCGCCGG + Intergenic
1176569369 21:8401743-8401765 GCGCGTGCCCCGCCGCGCGCCGG + Intergenic
1176577282 21:8445974-8445996 GCGCGTGCCCCGCCGCGCGCCGG + Intergenic
1176867478 21:14062336-14062358 CAGAGTCCCCCGCCACACGCTGG + Intergenic
1178840738 21:36135711-36135733 GAGGGCCCCGGGCCGCGCACAGG - Intronic
1181571172 22:23768390-23768412 GAGACTCCCAGGCCACGCGGTGG - Exonic
1203255336 22_KI270733v1_random:135043-135065 GCGCGTGCCCCGCCGCGCGCCGG + Intergenic
949461926 3:4303318-4303340 GACAGTCCTGGGCCGCGCGGTGG - Exonic
951544399 3:23810546-23810568 GAGAGTCCCGGCCAGCGTGCGGG + Intronic
952076340 3:29701832-29701854 GTGAGACTCCGGCTGCGCGCAGG - Intronic
953246436 3:41198897-41198919 GCGGGTTCCCGGCCGGGCGCGGG - Intronic
964474810 3:157088966-157088988 GCGTGTTCCCGCCCGCGCGCTGG - Intergenic
965837441 3:172867165-172867187 GCGAGTCCCGCGCCGTGCGCTGG - Intergenic
967055376 3:185825182-185825204 CAGAGTCCCGGGCCGGGCGGCGG + Intergenic
967271749 3:187738540-187738562 GAGAGTGCCAGTGCGCGCGCAGG - Intronic
968199559 3:196740264-196740286 GCGGCTCCCCGGCCCCGCGCGGG - Intronic
968747014 4:2365381-2365403 GAGAGGCCCCTGCTGCGTGCAGG - Intronic
969700252 4:8764079-8764101 GAGGGTCCCCGGCCGCCCCTTGG + Intergenic
969713712 4:8858622-8858644 GCGAGGCCCCGGCCGCCCGGGGG - Intronic
977177499 4:93834843-93834865 GAGGGGCCCCGGCCGAGTGCGGG - Intergenic
984701164 4:182819610-182819632 GAGGCTCCCCGGCCTCCCGCAGG + Intergenic
984758396 4:183343965-183343987 GTGAGTCCCCAGCCTCGGGCAGG + Intergenic
985264224 4:188143342-188143364 GAAAGTCCACGGCCGGGTGCCGG - Intronic
992529457 5:77640809-77640831 GCGAGTCCCTGGACGTGCGCGGG - Intergenic
1013538836 6:111087837-111087859 GAGGGTCCCGGGCCGGGCGGCGG - Exonic
1019337382 7:491793-491815 CAGAGTCCCTGGCCCCGAGCGGG - Intergenic
1020001664 7:4759525-4759547 GGGAGCCCCCCGCCGCGCCCTGG - Exonic
1022427692 7:30284645-30284667 GAGGTTCCCCGGCCCCGCGCCGG - Exonic
1023064894 7:36367277-36367299 GAGCGCCCCCAGCGGCGCGCAGG - Intronic
1029449732 7:100634037-100634059 GAGAGTCTCCGGCGCCGCCCTGG - Intronic
1031966571 7:128031709-128031731 GAGAGTCCGGGGGCGGGCGCGGG + Intronic
1035266859 7:157693822-157693844 GAGAGCTCCCGGCCGCCTGCTGG - Intronic
1036398207 8:8386409-8386431 GTGCGTGCCCGGCCGCGGGCGGG + Exonic
1061123182 9:128656697-128656719 GAGTGGCCCCGGCTGCGCGCGGG + Exonic
1061289395 9:129642114-129642136 GAGCGGACCCGGCCGGGCGCAGG - Exonic
1203471734 Un_GL000220v1:118180-118202 GCGCGTGCCCCGCCGCGCGCCGG + Intergenic
1189308508 X:40004989-40005011 GTCAGTCCCAGCCCGCGCGCAGG + Intergenic