ID: 1174899498

View in Genome Browser
Species Human (GRCh38)
Location 20:54483893-54483915
Sequence ATTTTGTTCTCTGGGATCCA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 300
Summary {0: 1, 1: 0, 2: 1, 3: 30, 4: 268}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1174899498_1174899503 22 Left 1174899498 20:54483893-54483915 CCCTGGATCCCAGAGAACAAAAT 0: 1
1: 0
2: 1
3: 30
4: 268
Right 1174899503 20:54483938-54483960 CTTAAGCCGAGTTGTTAACTAGG 0: 1
1: 0
2: 0
3: 3
4: 34

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1174899498 Original CRISPR ATTTTGTTCTCTGGGATCCA GGG (reversed) Intronic
901253609 1:7801115-7801137 CTTTTATTCACTGGGATCCGAGG - Exonic
903747481 1:25597715-25597737 TTGATGTTCTCTGGGATCTAGGG + Intergenic
905093651 1:35450234-35450256 AGATTGTTCTCTGAAATCCAGGG - Intronic
905750043 1:40454261-40454283 ATTCTGCTGTCAGGGATCCAAGG - Exonic
907204435 1:52756436-52756458 ATATTTTTCCCTGGGCTCCAAGG + Exonic
907720895 1:56971182-56971204 ATTCTGTCCTCCAGGATCCAGGG - Intergenic
909299786 1:73997811-73997833 ATTTTGTTCTCATTGATCCGTGG - Intergenic
912152825 1:106880604-106880626 AATATGCTGTCTGGGATCCAGGG - Intergenic
914987053 1:152469801-152469823 ATTTTATTCTCTTTGATACAAGG + Intergenic
916140097 1:161689379-161689401 ATTTTGTTCCCCAGGTTCCAAGG + Intergenic
916292662 1:163183790-163183812 ATTTCCTTCTCTGGCATGCAAGG - Intronic
916698571 1:167266539-167266561 AGATTGTTGTCTGGGATCAAGGG + Intronic
917242856 1:172967795-172967817 GTTTTGTTCTCTGGAAACCATGG + Intergenic
917751620 1:178058468-178058490 CTTTTGTTCTCTGGGAAATATGG + Intergenic
918743676 1:188170449-188170471 ATCTGGTTCTCTGGGAAACAAGG + Intergenic
919523634 1:198620608-198620630 ATTTTGTTCATTGGGATCAGTGG + Intergenic
922024578 1:221738825-221738847 ATTTTGGTCTTTGGTAGCCAGGG + Intronic
922112882 1:222579147-222579169 ATTTTGTTCTCTGGTAGACCAGG - Intronic
923655428 1:235911883-235911905 CGTTTTCTCTCTGGGATCCATGG - Intergenic
1062781152 10:209217-209239 ATGTTATTCTCAGTGATCCAGGG + Intronic
1063440687 10:6070478-6070500 ATTTTGTTCTCTGGTCTGCTTGG - Intergenic
1064457328 10:15499992-15500014 GTGTTTTTCTCTGGGATCCTGGG + Intergenic
1065491579 10:26287687-26287709 TTTTTGTTATCTGGTATACAAGG + Intronic
1065831963 10:29622600-29622622 AAGTTGTCCTCTGGGAACCAGGG - Intronic
1066612579 10:37265519-37265541 AATCTGTTCTCTGGGCTCCCAGG + Intronic
1068743142 10:60497901-60497923 GTTCTGTTCTCTGAGATACAGGG - Intronic
1069434693 10:68370318-68370340 ATTTTTTTCCCTTAGATCCAGGG - Intronic
1069659041 10:70111465-70111487 ATTTTGGTCCCTGGGACCCATGG - Intronic
1071352896 10:84764266-84764288 TTTTTGTTCTGTGGGCTCTAGGG - Intergenic
1074016768 10:109542490-109542512 TTTTAGTTCGCTGGGCTCCATGG + Intergenic
1074476636 10:113780398-113780420 TTTTTATTTTCTGGCATCCATGG - Intronic
1074763266 10:116683182-116683204 ACTTGGTTCCCTGGTATCCAGGG - Intronic
1076384144 10:130045056-130045078 CCTCTGTTCTCTGGGGTCCAGGG + Intergenic
1077741123 11:4846973-4846995 CTTCAGTTCTCTGGGAACCAGGG + Intronic
1078486667 11:11729511-11729533 ATTTATTTGTCTGGAATCCAAGG - Intergenic
1078563223 11:12391018-12391040 ATTCTGTTCTCTGGGAACTTGGG - Intronic
1079540990 11:21574354-21574376 ATTTAGTTCTCTGGGACTGAAGG - Intronic
1079944451 11:26724577-26724599 ATTTTCTTCTCTTTGATCCCAGG - Intergenic
1080933564 11:36838559-36838581 ATTTCTTTCTATGGGATCCCTGG + Intergenic
1081037024 11:38161329-38161351 ATTCTGTTCTCAGGGATGCGGGG + Intergenic
1082040741 11:47682815-47682837 ATTGTGCTCTGTGGAATCCAGGG + Intronic
1084932231 11:72565709-72565731 ATTTTTTTCTAAGGGATGCAAGG - Intergenic
1086095623 11:83047408-83047430 AATTTATTCTCTTGGGTCCATGG - Intronic
1087901060 11:103641666-103641688 ATTTGTTTCTCTGGGTTACATGG + Intergenic
1090959633 11:131544626-131544648 GTTTTCTTCTCTGAGTTCCAGGG + Intronic
1092736589 12:11588476-11588498 TTTTTGTTCTGTGGGTTCGAGGG - Intergenic
1093244430 12:16718878-16718900 ATTTTATTCTTTGGGTTTCATGG - Intergenic
1093896732 12:24583201-24583223 TTTTTCTTCTCTGGGATCCCAGG - Intergenic
1094017398 12:25879666-25879688 ATCTTGTTCTCTGAGTTCTAAGG - Intergenic
1094452805 12:30600626-30600648 ATTTTCCTCTCTGGGATCTGAGG - Intergenic
1094512774 12:31106146-31106168 AAGTAGTTCTCTGGGACCCATGG + Intergenic
1094801209 12:34037962-34037984 ATTTTGTTCTTTGAAATGCAGGG + Intergenic
1095114342 12:38333954-38333976 ATTTTGTTCTTTGAAATGCAGGG + Intergenic
1097391392 12:59019145-59019167 ACGTTGTTCTTTGGGATTCAAGG + Intergenic
1099402800 12:82220792-82220814 ATTTTATTCTCAGCTATCCAAGG + Intergenic
1099633033 12:85175009-85175031 CTATTGTTTTCTAGGATCCAAGG - Intronic
1099700952 12:86081051-86081073 ATTTGTTTCTCTGTGATCCAAGG + Intronic
1099891183 12:88590327-88590349 ATTTTATTCTCTAGGTACCAAGG - Intergenic
1102032811 12:109752848-109752870 GTTCACTTCTCTGGGATCCAAGG + Intronic
1102036421 12:109772932-109772954 AGTTGGGGCTCTGGGATCCAAGG - Intergenic
1104061893 12:125275681-125275703 ATTTTGTTATCTTGCATCCTTGG + Intronic
1105940089 13:25140325-25140347 ATTTTGTTCTCTGAGAGCTGTGG - Intergenic
1107455278 13:40549342-40549364 AGATTTTTCTCTGGGCTCCAGGG - Intergenic
1108329833 13:49374444-49374466 CTTTTATTCTCTGGAATCCTTGG - Intronic
1108936233 13:55884594-55884616 TTTGTGTTCTTTGGGCTCCATGG + Intergenic
1108954566 13:56136689-56136711 ATAATGTTCACTGTGATCCATGG + Intergenic
1109250212 13:60010592-60010614 ATTGGGGTGTCTGGGATCCACGG + Exonic
1109677617 13:65699714-65699736 ATTTTGTTTTCTCAAATCCATGG - Intergenic
1110027228 13:70555954-70555976 ATTATTTTCTCTGGGATGTAGGG + Intergenic
1110246550 13:73331584-73331606 GTTTTCTTCTGTGGGTTCCAGGG - Intergenic
1110411429 13:75207953-75207975 ATTTAGTACTCTGTGATGCATGG + Intergenic
1111584420 13:90265928-90265950 ATTTTATTTGCTGGGATCAAAGG + Intergenic
1111839653 13:93434088-93434110 ATATTGCTCTCTGGCATCCAGGG + Intronic
1112588172 13:100738259-100738281 TTTCTGTTCTCTGGGACTCAGGG + Intergenic
1114072093 14:19120076-19120098 ATTCTGTTCTTGAGGATCCATGG + Intergenic
1114090163 14:19279888-19279910 ATTCTGTTCTTGAGGATCCATGG - Intergenic
1114277134 14:21156840-21156862 ATTTTGTTCTCTGGAAATGATGG - Intergenic
1116328959 14:43571504-43571526 ATTTTGTTATCAGGAATTCAAGG - Intergenic
1116639326 14:47440809-47440831 ATTATTTCCTCTGGAATCCAAGG + Intronic
1117311914 14:54534408-54534430 ATTTTGTCCTCTGGGAGCAGTGG - Intronic
1117583372 14:57175249-57175271 ACTTTATTCTATGGAATCCAAGG + Intergenic
1118180054 14:63483620-63483642 ATTTTCTGCTGTGGGGTCCAAGG + Intronic
1119461587 14:74809366-74809388 ATTCTGTTCTCTAGCCTCCAGGG + Exonic
1122157794 14:99760897-99760919 ATTTTGCTCTCTGCTACCCATGG + Intronic
1202832845 14_GL000009v2_random:56051-56073 ACTTTCTTCTCTAGAATCCACGG + Intergenic
1125337707 15:38643635-38643657 ATCTTCTTTTCTGGGATCTAGGG - Intergenic
1125777735 15:42233232-42233254 CTTTTGTTCTCTGGCATGGAAGG - Exonic
1126513764 15:49510982-49511004 TTTTTGTTCTCTGGGTTCTGAGG + Intronic
1126794211 15:52246549-52246571 TTCTTGTTCTCTGGGACCCATGG - Intronic
1128715915 15:69907957-69907979 AAGTTGTTCTCTGGGTTTCAGGG + Intergenic
1129368481 15:75071550-75071572 ATGTTGGTGTCTGGGATCCAAGG - Intronic
1129580822 15:76808053-76808075 TCTTTATTCTCTGGGATCCCAGG - Intronic
1129795130 15:78370285-78370307 GTTTTTTTCTGTAGGATCCAAGG - Intergenic
1133496393 16:6322227-6322249 AATCTGTTGGCTGGGATCCAAGG - Intronic
1134444705 16:14321990-14322012 GTATTGCTCTCTAGGATCCAGGG - Intergenic
1136069052 16:27777316-27777338 ACTTGGGTCTCTGGTATCCAGGG - Intronic
1136119233 16:28119645-28119667 TTTTTTTTTTCTTGGATCCAAGG - Intronic
1138481140 16:57304104-57304126 ATTTTGGTCTCAGGGACCTAGGG - Intergenic
1140211883 16:72976997-72977019 ATGTTTTTCTCTGGGATGAAGGG + Intronic
1140297337 16:73721672-73721694 ATATTGTTCTCATGGAGCCAGGG - Intergenic
1140968406 16:79989624-79989646 ATGTTGTTTTCTGAGATCCCTGG + Intergenic
1141513554 16:84527980-84528002 TTTCTGTTCTCTGTGATCTAGGG - Intronic
1141847484 16:86620846-86620868 ATTTTGTTCTCTGGTATTCTGGG + Intergenic
1141869991 16:86778760-86778782 AGCTTCTTCTCTGGGATACAGGG - Intergenic
1143804870 17:9417954-9417976 ATTTTGTTACCAGGGATGCAAGG - Intronic
1144750294 17:17643934-17643956 AGTTGGCTCTCTGGTATCCAGGG - Intergenic
1149621328 17:58047474-58047496 ATCTCCTTCTCTGGGTTCCAAGG - Intergenic
1151973907 17:77473506-77473528 ATTTTTTTAACTGGGATCCACGG + Intronic
1156883363 18:42106470-42106492 CTTTTGTTCTCTGGGTTTCCTGG + Intergenic
1157423553 18:47565831-47565853 ACTTTGTTCACTGGAACCCAAGG - Intergenic
1158034033 18:53003016-53003038 ATTTTGTTTTGTAGGAGCCAAGG + Intronic
1158084344 18:53633122-53633144 ATCTTCATCTCTGGGATACAAGG + Intergenic
1158085084 18:53641445-53641467 ATCTTCATCTCTGGGATGCAAGG + Intergenic
1158188913 18:54803419-54803441 ATTTTGTTCTCAAGGATCTTTGG - Intronic
1158489872 18:57900361-57900383 ATTTTAATTTCTGGGGTCCACGG - Intergenic
1158569909 18:58589405-58589427 ATTTTGTGCTTTGGGAACAAGGG + Intronic
1158788620 18:60746775-60746797 ATTTTGTCCTCTGGGTAGCAGGG - Intergenic
1160055242 18:75472736-75472758 TTTTCGTTCTCTGGTTTCCATGG - Intergenic
1163807425 19:19407611-19407633 ATTTTCTTGTCCAGGATCCAGGG + Intronic
1164291473 19:23872810-23872832 ATTTTATGTTCTGGGATCCCAGG - Intergenic
1165529905 19:36389949-36389971 TTGTTGGTCTCTGGGATCTAGGG - Intronic
1166154927 19:40903815-40903837 ATTAAGGACTCTGGGATCCAGGG - Intergenic
1167351263 19:48976313-48976335 CTTTCATTCTCTGGGGTCCAGGG - Intronic
1202639838 1_KI270706v1_random:71673-71695 ACTTTCTTCTCTGGAATCCACGG - Intergenic
925426197 2:3750712-3750734 TTTCTGTTCTTTGGCATCCATGG + Intronic
926947003 2:18199338-18199360 TTTTTGTTCTTTAGAATCCATGG + Intronic
927000893 2:18793220-18793242 ATTTTGTTTTCTGTCAACCATGG + Intergenic
927974732 2:27329581-27329603 ATTTCTTTCTCTGGGCTCCTAGG + Intronic
928243381 2:29605957-29605979 ATTTTTTTCTTTGGGACCCAAGG - Intronic
931203421 2:60123438-60123460 ATGTTTTTCTTTGGGATCTATGG - Intergenic
935469424 2:103439303-103439325 ATCTTGTTTTCTGTGATCCATGG + Intergenic
936511694 2:113153487-113153509 ATTTTGTCCTCTGGCCTACATGG + Intergenic
938691981 2:133800221-133800243 ACTTTGCTCTCTGGGCTTCAGGG + Intergenic
939179423 2:138786315-138786337 TTTTTGTTCTCTGCTCTCCAGGG - Intergenic
939819849 2:146944424-146944446 ATTTAATTCTTTGGGATCCTGGG - Intergenic
939871462 2:147530923-147530945 ATTTGTTTCTCTGGTATCCATGG + Intergenic
940189070 2:151019368-151019390 ATTCTGTTTTCTGGCTTCCATGG - Intronic
943113590 2:183638512-183638534 ATTTTGTTCTCTGTGCTTGAAGG + Intergenic
943250693 2:185518438-185518460 AGTTTCTTCCCTGGGATGCAAGG - Intergenic
944078025 2:195754202-195754224 ATTTTTTTCTCTGGCATTTAAGG + Intronic
944606052 2:201352328-201352350 GTTTTGTTTTTTGGGAGCCAGGG - Intronic
946420043 2:219559636-219559658 AGTTTGTTCTCTGAAATCCCTGG + Intronic
1169333792 20:4738380-4738402 ATGTTCTACTCTGGCATCCAGGG - Intronic
1169520353 20:6365000-6365022 ATTTTATTCTCTAAGACCCAGGG - Intergenic
1174899498 20:54483893-54483915 ATTTTGTTCTCTGGGATCCAGGG - Intronic
1175908302 20:62392620-62392642 ATTTTGTTCTCAGAGATTCGGGG - Intronic
1176159094 20:63639489-63639511 ACTTTCCTCTCTGGAATCCAAGG - Intergenic
1176585505 21:8580667-8580689 GTTTTGTTCTGTGGCCTCCATGG + Intergenic
1176648168 21:9369273-9369295 ACTTTCTTCTCTAGAATCCACGG - Intergenic
1177732816 21:25050682-25050704 ATATTTATCTCTGGGATCCAAGG + Intergenic
1179159781 21:38884919-38884941 TTTTTGGTCTCTGCTATCCAGGG + Intergenic
1180268313 22:10557566-10557588 GTTTTGTTCTGTGGCCTCCATGG + Intergenic
1180362102 22:11910197-11910219 ACTTTCTTCTCTGGAATCCACGG + Intergenic
1180490535 22:15842431-15842453 ATTCTGTTCTTGAGGATCCATGG + Intergenic
1182030288 22:27154047-27154069 AGTATGTTTTCTGTGATCCAGGG - Intergenic
1182415398 22:30218006-30218028 TTTTTGTTCTCTGGAATGCCAGG + Intergenic
1183338200 22:37262999-37263021 TTTTGGTTCTCTGGGGTCCCTGG - Intergenic
1183468518 22:37992897-37992919 ATTTTGTTCCCAGGGTTCCTGGG + Intronic
1184045067 22:41967981-41968003 ATCTTCTTCTCTGGGCCCCAGGG - Intergenic
1184909478 22:47518050-47518072 ATTTTGTTCCCAGAGCTCCATGG - Intergenic
949255019 3:2035735-2035757 ATTTTGTCTTCTTGGAGCCAGGG + Intergenic
949283493 3:2374031-2374053 CTTTTGTTCTCCGGGATACATGG + Intronic
949962414 3:9323587-9323609 GTCTTGATCTCTGGGATCCAAGG + Intronic
950174734 3:10865052-10865074 ATGTTGTTCTCTGCCAGCCAAGG + Intronic
950817600 3:15722681-15722703 ATTTTCTTTTCTGGGATCACTGG + Intronic
951311203 3:21128199-21128221 TTTGTATTCTGTGGGATCCATGG - Intergenic
951348572 3:21576686-21576708 ATTGAGTGCTCTGGGTTCCAGGG - Intronic
952049865 3:29371690-29371712 ATTTTGTTTTATTGGTTCCAAGG + Intronic
953210245 3:40869125-40869147 ATTTTTTCCTCTGGGACCCATGG - Intergenic
955169416 3:56548809-56548831 GTTTTGTTTTCTAGCATCCATGG - Intergenic
955520275 3:59768999-59769021 ATATTGTTATGTGGGATCCAGGG - Intronic
956022558 3:64948125-64948147 ATTTAGTTCTCTGGGCTCCAAGG + Intergenic
957075771 3:75602335-75602357 ATATTGTTTTCTGACATCCAAGG + Intergenic
960317340 3:116194329-116194351 GTTTGATTCTTTGGGATCCACGG - Intronic
960430779 3:117565936-117565958 CTTTTGTTCTCTGGAATCAGAGG + Intergenic
960864889 3:122189493-122189515 TTTTTTTTCCCTGGGAACCAGGG + Intronic
960938445 3:122917815-122917837 ATATTTTCCTCTGGGATCAATGG + Intronic
961275517 3:125722846-125722868 ATATTGTTTTCTGACATCCAGGG - Intergenic
961875967 3:130024188-130024210 ATATTGTTTTCTGACATCCAGGG + Intergenic
963324966 3:143852294-143852316 AGTCTGGTCTGTGGGATCCAGGG + Intergenic
964160161 3:153636895-153636917 AATTCCTTCTCTGAGATCCATGG + Intergenic
964812454 3:160680289-160680311 CCTTTCTTCCCTGGGATCCAGGG + Intergenic
965679810 3:171238126-171238148 ATATTGTTCTCTGGGAAGGAGGG + Intronic
965897109 3:173591985-173592007 ATTTTCTTCTGTGGGATCACAGG + Intronic
1202738718 3_GL000221v1_random:35714-35736 ACTTTCTTCTCTAGAATCCACGG + Intergenic
969260895 4:6032816-6032838 ACTTTGTACTCTGGGCACCAGGG + Intronic
970101285 4:12524953-12524975 ATTTTGTTCTCTGTCCTTCAAGG - Intergenic
970542190 4:17091326-17091348 AGTTGGTTCTCCGGGCTCCAGGG - Intergenic
971431307 4:26570800-26570822 ATTTTCTTCCATGTGATCCATGG + Intergenic
973087376 4:46082490-46082512 TATTTATTCTCAGGGATCCATGG + Intronic
973198112 4:47468456-47468478 TATTTGTTCTGTGTGATCCATGG + Intergenic
973370077 4:49238023-49238045 ACTTTCTTCTCTAGAATCCACGG - Intergenic
973390948 4:49557387-49557409 ACTTTCTTCTCTAGAATCCACGG + Intergenic
974266969 4:59598224-59598246 ATGATGTTATCTGGGATCTAAGG - Intergenic
976067220 4:81201722-81201744 ATTTTATTCTCTGGCTTCTATGG + Intronic
976315244 4:83652951-83652973 ATTTTCTTATCTGTAATCCAGGG + Intergenic
976456056 4:85247751-85247773 ATGTTGTTCCCTAGGATTCAAGG - Intergenic
980329957 4:131398721-131398743 GTTTTCTTCTCAGGTATCCATGG + Intergenic
980427200 4:132641376-132641398 GTTTTGATATCTGAGATCCAGGG + Intergenic
980914222 4:139019429-139019451 ATTTGGTTATGTGGAATCCAGGG - Intronic
981295164 4:143123431-143123453 ATATTTTTCTCTGGGAACCAAGG + Intergenic
981347307 4:143691070-143691092 ATTTTTTTCCCTTAGATCCAGGG - Intronic
982144268 4:152365653-152365675 TTTTTGTTTTCTGGGGGCCAGGG + Intronic
983046522 4:162993643-162993665 CTTTTGTTCTCTGCCTTCCAAGG - Intergenic
983129601 4:164000380-164000402 ATTTTGTTTTCTGGCATCCCTGG - Intronic
984270571 4:177543881-177543903 AATTAGTTATCTGGGATACAGGG - Intergenic
984537398 4:180993939-180993961 GTTTTGTTCAGTGGGATCAAGGG - Intergenic
1202767194 4_GL000008v2_random:157528-157550 ACTTTCTTCTCTAGAATCCACGG - Intergenic
985698719 5:1357956-1357978 ATTATGTTCTCTGGAACACAGGG + Intergenic
986374909 5:7121099-7121121 ACTTTGTTCTCGTGGATTCAAGG - Intergenic
986835914 5:11636914-11636936 ATTTATTTCTCTGAGTTCCAAGG + Intronic
987144381 5:14978126-14978148 ATTTAGTTCTCAGAGATGCATGG + Intergenic
987502306 5:18728977-18728999 ATTGTGTCCTCTGGAATTCATGG + Intergenic
988901971 5:35743414-35743436 ATGTTGTTTTCTAGTATCCATGG - Intronic
989250993 5:39314823-39314845 ATTAAGTTCTGTGGGATACAAGG - Intronic
989296021 5:39827657-39827679 ATTTTGTTCTTTGTGCTCCCAGG + Intergenic
989417609 5:41198480-41198502 ATTTTGGGCTCTGGGAAGCAGGG + Intronic
990823245 5:59867197-59867219 ATCTTCTTCTCTGGGATCAAGGG - Intronic
992039252 5:72813176-72813198 ATGTTGTTCCTTGGGTTCCAAGG + Intergenic
993313262 5:86364953-86364975 ATTTTTTTATCTGGATTCCAGGG + Intergenic
994236471 5:97369085-97369107 ATTTTGTTCTCCGGACCCCAAGG - Intergenic
995039862 5:107575386-107575408 ATTTTCTCCTTTGGGATACATGG - Intronic
996943921 5:129043675-129043697 ATTTTGTTCTCTGTGGTCCTGGG - Intergenic
999207203 5:149857720-149857742 ACTATGTTCTCTGTGATCCTGGG + Intergenic
1000991129 5:167913051-167913073 TTTTTTTTCTCTGGAATGCAGGG - Intronic
1001524619 5:172419670-172419692 ATTTTCTGCTCTGGGTTTCAGGG + Intronic
1001977681 5:176013746-176013768 ATATTATATTCTGGGATCCATGG + Intronic
1002239738 5:177830019-177830041 ATATTATATTCTGGGATCCATGG - Intergenic
1004491650 6:16122900-16122922 GGTTTGTTCTCTGGGCTTCAAGG - Intergenic
1005310240 6:24552108-24552130 ATTTTGTTCTCTGCGTGCCTTGG - Intronic
1005594946 6:27370006-27370028 ATTTTATTTTCTAGGAACCAAGG - Intergenic
1005827802 6:29645600-29645622 ATTTTCTTCTCTGGACCCCAAGG + Intergenic
1010172052 6:72986388-72986410 TTTTTCTTCTCTGGGAGCCCAGG - Intronic
1011324346 6:86132837-86132859 AGTTTTATCTCTGGGATGCAAGG - Intergenic
1012749342 6:103138326-103138348 ATTTTATTCACTTAGATCCATGG - Intergenic
1013937235 6:115612116-115612138 ATTTTCTTCTCTGGGCTTCTTGG + Intergenic
1014184241 6:118417242-118417264 AATTTGTTCTCTGGCAAACATGG - Intergenic
1015127242 6:129768628-129768650 ATTTTGTTATCTGCAAACCATGG - Intergenic
1016126723 6:140412630-140412652 ATTTTATTCTTTGGTTTCCATGG - Intergenic
1018670013 6:166169505-166169527 CTTTTGATGTCTGGGATGCATGG + Intergenic
1018716892 6:166539990-166540012 ATAGTGTGCTCTGGGAACCAGGG + Intronic
1019844951 7:3489126-3489148 ATTCTGTTCACTTGGGTCCAGGG - Intronic
1020940953 7:14536475-14536497 ATATTTATCTCTGGGATGCAAGG + Intronic
1022813530 7:33892314-33892336 GTCTTGTGCTCTGGGATGCAGGG - Intergenic
1023424023 7:40015123-40015145 ACTTTCTTCTCTGGGTTTCAAGG + Intronic
1024089284 7:45921774-45921796 ATTTGGGTCTCAGGGAGCCAAGG + Intronic
1026327087 7:69319926-69319948 ATTTTATTATCTGGGTTCTACGG - Intergenic
1026357718 7:69573842-69573864 ATTTTTTTCTCTTTGATACAGGG - Intergenic
1026382225 7:69811270-69811292 GTTTTCTTCTCTGTGATCTAGGG + Intronic
1028105933 7:86878820-86878842 ATTGTTTGCTCTGGGATTCAGGG - Exonic
1029955283 7:104632269-104632291 ATTTGGGTCTCTGGGAGGCAGGG - Intronic
1030078401 7:105756503-105756525 ATGTTGTACTCTAGGGTCCAGGG + Intronic
1030528013 7:110676597-110676619 ATTTTATTATCTGGGAATCAAGG + Intronic
1034411505 7:150944723-150944745 TTTTTGTTATCTTGAATCCAGGG + Intergenic
1038464265 8:27745836-27745858 TTTTGGTTTTCTGAGATCCATGG + Intronic
1040460798 8:47645968-47645990 AATTTTTTCTTTTGGATCCATGG - Intronic
1041470881 8:58207475-58207497 TTTTATTTCTGTGGGATCCATGG + Intergenic
1041579110 8:59436243-59436265 ATTTTTTTCTCTGGAATTCAAGG - Intergenic
1042849311 8:73200284-73200306 ACTCTGTTCTCTGGGATTCAGGG - Intergenic
1043013578 8:74910456-74910478 ATTTTGTTTTCTTGTATCTATGG + Intergenic
1043571720 8:81611242-81611264 ATTTTGTTATCAGGGCTCCTTGG - Intergenic
1045227948 8:100268894-100268916 ATTTTCTTCTTTCGGCTCCAGGG + Exonic
1045647305 8:104311885-104311907 AGTTTGTTCTGTGGAATCGATGG - Intergenic
1047568469 8:126072620-126072642 TTTTTCTTCTCTGGGAGCCCAGG - Intergenic
1048825044 8:138416140-138416162 ATTTTGTCCTGGGGGATCAAGGG - Intronic
1049831755 8:144705264-144705286 ATTCTGTTCTCAGGGCCCCAAGG - Intergenic
1049833590 8:144718390-144718412 ATGTTGTGCTGTGGGATACAAGG + Intergenic
1051300148 9:15641500-15641522 ATTTGGTTCTATGGTTTCCATGG - Intronic
1052308413 9:27037725-27037747 ATTTTGTTCTTAAGGACCCAGGG - Intronic
1055015642 9:71614956-71614978 ATTCTGTTCTATGGGAGACATGG - Intergenic
1055373021 9:75620684-75620706 AGCTTTTTCTCTGGGATGCAAGG - Intergenic
1055515109 9:77025570-77025592 TTTTTGTCCTCTGGAATTCAAGG - Intergenic
1056274741 9:84983211-84983233 ATTTAGTTTTCAGGGAACCATGG - Intronic
1057970923 9:99556771-99556793 TCTTTGTTCTCTGTGATCCATGG - Intergenic
1058829007 9:108798826-108798848 CTCTTGTTCTTTGGGTTCCAGGG - Intergenic
1060032577 9:120228119-120228141 ATTTTGATCTCTGTGATATATGG + Intergenic
1203707448 Un_KI270742v1:66158-66180 ACTTTCTTCTCTAGAATCCACGG + Intergenic
1203547946 Un_KI270743v1:142405-142427 ACTTTCTTCTCTAGAATCCACGG - Intergenic
1187838949 X:23465546-23465568 CTTTTGTTCTCTGCAACCCAAGG - Intergenic
1188562724 X:31488016-31488038 ATTGTATTCTCTGAGATCAAGGG + Intronic
1188813626 X:34684122-34684144 ATTTTTTTTTCTGGGATGCAAGG - Intergenic
1188883676 X:35522611-35522633 GTTTTGTTCTTTGGGAACAATGG - Intergenic
1191737081 X:64398329-64398351 ATTTTGTTCACTTGGCTCCAGGG + Intergenic
1192006574 X:67220167-67220189 AGTTTCTTCTCTGGGATGCAAGG - Intergenic
1192444102 X:71197502-71197524 ATTTCGTTCTCTGCCCTCCAGGG - Intergenic
1192638680 X:72844016-72844038 ATATTGTTCTCCTGGATCCCTGG - Intronic
1192643032 X:72876792-72876814 ATATTGTTCTCCTGGATCCCTGG + Intronic
1193139983 X:78017314-78017336 ATTTTGTGGGCTGGGAACCAGGG - Intronic
1193151519 X:78129356-78129378 ACTATGTTCTAAGGGATCCAAGG - Intergenic
1194386938 X:93266981-93267003 TTTTTTTTCTCTTGGATCAAAGG + Intergenic
1194696275 X:97055133-97055155 ATTCTGTTGTCTGGGCTCAAAGG + Intronic
1195021327 X:100831702-100831724 ATTTTGTTCTCAGGGAAGAAGGG - Intronic
1195945261 X:110203529-110203551 ATTCTGTTCTCTTGGATCTGTGG + Intronic
1197278120 X:124503648-124503670 ACTTTATTCTCTGGGAGCAAAGG - Exonic
1199186779 X:144924625-144924647 ATTTTGTTACATGGGATCCATGG + Intergenic
1199203119 X:145116609-145116631 AGTTTTTTTTCTGGGATGCAAGG + Intergenic
1200679079 Y:6187435-6187457 ATGTTTATCTCTGGGATGCAAGG + Intergenic
1200697964 Y:6377717-6377739 CTTTTGCTCTCTGGAATCCCTGG + Intergenic
1200923297 Y:8632076-8632098 CTTTTGCTCTCTGAGATCCCTGG - Intergenic
1201036148 Y:9786982-9787004 CTTTTGCTCTCTGGAATCCCTGG - Intergenic