ID: 1174901283

View in Genome Browser
Species Human (GRCh38)
Location 20:54503849-54503871
Sequence AAACTGCAGCCTATGAAGAT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 185
Summary {0: 1, 1: 0, 2: 1, 3: 12, 4: 171}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1174901279_1174901283 24 Left 1174901279 20:54503802-54503824 CCTGACATCAGAAGTGAAGATGG 0: 1
1: 0
2: 0
3: 20
4: 200
Right 1174901283 20:54503849-54503871 AAACTGCAGCCTATGAAGATGGG 0: 1
1: 0
2: 1
3: 12
4: 171

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1174901283 Original CRISPR AAACTGCAGCCTATGAAGAT GGG Intronic
900886920 1:5421748-5421770 AAAGTGCAGCCTTTGAAGACTGG - Intergenic
900926141 1:5707352-5707374 AGACTGCAGCATGTGGAGATCGG - Intergenic
903039740 1:20520200-20520222 AAGGTGTAGGCTATGAAGATGGG + Intergenic
903971194 1:27119945-27119967 AGAGGGCAGCCTTTGAAGATAGG - Intronic
904524164 1:31120018-31120040 AAACTGGTGTCTATGAAGACAGG - Intergenic
905161381 1:36038183-36038205 ATACTGCAGGCTATGAGGCTAGG + Intronic
907600987 1:55769243-55769265 AAACTTCAGCATATGAACTTGGG - Intergenic
909988393 1:82191136-82191158 AGAGTGCAGCCGATGAAGAATGG - Intergenic
916598778 1:166272317-166272339 AAGCTGAAGACCATGAAGATGGG + Intergenic
916747048 1:167692654-167692676 AAAAAGCAGCATATGAAGCTGGG - Intronic
917563923 1:176191655-176191677 TAACTGCTGCCTGTGAAGATTGG - Intronic
918761344 1:188414227-188414249 TAACTGAAACCCATGAAGATGGG + Intergenic
1063519439 10:6727581-6727603 ACACAGCAGCCTATGAAGTGAGG - Intergenic
1064561449 10:16598608-16598630 ACACTGCAGTCTCTGAAGATGGG + Intronic
1064785711 10:18892140-18892162 AAATTGCAGCCACTGAGGATAGG - Intergenic
1066382807 10:34915896-34915918 CAACTTCAGCCTATAAAGGTAGG + Intergenic
1067199809 10:44157223-44157245 GAACTGCAGCTAATGAAAATAGG + Intergenic
1073772447 10:106750272-106750294 AAGCTGCAGCCTATGGGGACAGG + Intronic
1076177017 10:128375941-128375963 AAAATGCTGCCTAAGAAGGTAGG - Intergenic
1077114078 11:875214-875236 CAACTGAAACCTGTGAAGATAGG - Intronic
1079682105 11:23310464-23310486 AAGCTGCAGCCAAAGAACATAGG + Intergenic
1081455876 11:43222172-43222194 AAACTGCATCCTTTCAAGATTGG + Intergenic
1081967777 11:47179862-47179884 AAACTGCAGCATCTCAGGATGGG + Intronic
1082984974 11:59160738-59160760 ACACTGCTGGCTTTGAAGATGGG + Intergenic
1087776951 11:102265272-102265294 GAAGTGCAGCCTAGGAAGAAAGG + Intergenic
1088007975 11:104965431-104965453 AAGGTGTAGGCTATGAAGATGGG - Intronic
1088017329 11:105076903-105076925 AAGATGTAGGCTATGAAGATGGG - Intronic
1089637668 11:119826533-119826555 CACCTGGAGCCTATGATGATGGG + Intergenic
1092590491 12:9949174-9949196 AAACAGCAGCCAATGAATAGAGG + Intergenic
1092970716 12:13692234-13692256 AAAATGGAAACTATGAAGATAGG + Intronic
1093750333 12:22791724-22791746 ACAACGCAGCCTATGTAGATTGG + Intergenic
1094431023 12:30369206-30369228 AAGGTGTAGGCTATGAAGATGGG + Intergenic
1097671672 12:62546886-62546908 CAACTGCAGCCTCTGAAAAGGGG - Exonic
1098904254 12:76145593-76145615 AACCCACAGCCTATGAAGATGGG + Intergenic
1100939350 12:99708613-99708635 AAACTGTTGGCTTTGAAGATGGG - Intronic
1101727972 12:107403750-107403772 AAACTTCAGACAATGAAGTTTGG + Intronic
1105538355 13:21291371-21291393 AAGGTGCAGGCTATGAAGATGGG + Intergenic
1107601181 13:42014129-42014151 AAAATGCAGAAAATGAAGATTGG + Intergenic
1111245566 13:85534753-85534775 AAACTGCATCACATCAAGATTGG + Intergenic
1112133402 13:96549068-96549090 AAACTGCACCGTATGAGGAATGG - Intronic
1112750520 13:102578845-102578867 GAACTGCACCCTGTGAGGATGGG + Intergenic
1114980681 14:28159075-28159097 AAACTACAGCCTCTGATCATTGG - Intergenic
1115352964 14:32415987-32416009 ATAATGCTGCTTATGAAGATGGG + Intronic
1116625316 14:47255609-47255631 AAACTTCATCCTATGGAAATTGG - Intronic
1116934766 14:50728147-50728169 AAACAGCAGGCTTTGAAAATAGG + Intronic
1117344092 14:54815758-54815780 AAACTGACGCCCAGGAAGATTGG + Intergenic
1118699528 14:68419685-68419707 CACCTTTAGCCTATGAAGATGGG - Intronic
1118904554 14:70014202-70014224 AAGCTGCATCCTTTGAAGGTGGG - Intronic
1119277200 14:73368870-73368892 AAACTGCAGCATTTGAAAAGTGG + Intronic
1128012884 15:64315276-64315298 AAGCAGCAGCCTATTAAGAAAGG + Intronic
1128641137 15:69338630-69338652 AAGGTGTAGGCTATGAAGATAGG - Intronic
1130370403 15:83281680-83281702 AAACTGCAGCTTATGGAGTGGGG - Intronic
1130837804 15:87668831-87668853 AAGGTGTAGGCTATGAAGATGGG - Intergenic
1130999621 15:88929390-88929412 AAGGTGTAGGCTATGAAGATGGG - Intergenic
1132677065 16:1125215-1125237 AAGCTGAGGCCTATGGAGATGGG + Intergenic
1134876551 16:17704977-17704999 AAATTGCTGCCTTTGAAGATGGG + Intergenic
1137460301 16:48655340-48655362 AAGGTGTAGGCTATGAAGATGGG + Intergenic
1138030761 16:53557864-53557886 AAAATGCAGCCTTGGTAGATTGG + Intergenic
1138184203 16:54963864-54963886 TAGCTGCAGACTATGAAAATGGG + Intergenic
1139184012 16:64782440-64782462 AGCCTGTAGCCTGTGAAGATTGG + Intergenic
1139407367 16:66729735-66729757 AAAAAGAAGCCTATAAAGATGGG - Intronic
1139668133 16:68472537-68472559 AGACTGAAGCCTATGAAGGGTGG + Intergenic
1143241215 17:5444727-5444749 AAACTACCGCCTGTGAAGGTAGG + Intronic
1150008489 17:61484378-61484400 CATCTGCATCCTATGATGATGGG + Intronic
1151256952 17:72885234-72885256 AAACAGCTTCCTATGAAGCTTGG + Intronic
1153117667 18:1679141-1679163 ACACTGCTGGCTTTGAAGATGGG - Intergenic
1153303949 18:3615584-3615606 AAAATGGAGCCGATGGAGATGGG + Intronic
1159242133 18:65754987-65755009 AAAATGCAGACTAAGAAGAAAGG - Intronic
1162666085 19:12213222-12213244 ACAGTGCATCCTATGAAAATCGG - Intergenic
1163247955 19:16109002-16109024 AAACTGCGGCCTGGGAAGCTTGG + Intergenic
926654114 2:15380857-15380879 TAAGAGCATCCTATGAAGATTGG - Intronic
926659921 2:15453406-15453428 AAACAGCAGTTTCTGAAGATGGG + Intronic
927162735 2:20283747-20283769 AAACTACAGGCTATGAAGGAAGG + Intronic
928020739 2:27702732-27702754 AAACTGAGGCCTATGCAGAAAGG - Intergenic
934474458 2:94584919-94584941 GGAGTGCAGCCTATAAAGATGGG - Intergenic
937563976 2:123261371-123261393 AAAATGGATCCTATGAGGATAGG + Intergenic
938955823 2:136297251-136297273 AAACAACAGCCTACGAATATAGG - Intergenic
939591096 2:144064887-144064909 AAACTGGCTCCTATGAAAATGGG + Intronic
939686569 2:145207739-145207761 AAATTGCAGCCCATGAAGCATGG - Intergenic
941626081 2:167831820-167831842 AAACTGCAACATATGTAGAGAGG + Intergenic
941890004 2:170570463-170570485 AAACTGCTGCTTATAAAGGTTGG + Intronic
942383682 2:175419724-175419746 AAACAGCAGCAGATGAGGATGGG - Intergenic
943107414 2:183562959-183562981 AAAATGCAGCATATGAAGACAGG + Intergenic
944501407 2:200364076-200364098 ACGCTGCAGGCTTTGAAGATGGG + Intronic
944652987 2:201850589-201850611 AAACTGCATTCAATGAACATGGG + Intronic
945284929 2:208072658-208072680 AGACTACAGCCTATGCAGAAAGG - Intergenic
947521725 2:230850653-230850675 AAACAGCAGGCTAGGAAGAAAGG + Intergenic
1170297369 20:14842913-14842935 AAAGTGCACCCTCTGAAGACAGG - Intronic
1172577599 20:36021351-36021373 AAACTGGATCTCATGAAGATAGG + Intronic
1174713777 20:52735075-52735097 AAACTGCAGTCTACGGAGGTAGG + Intergenic
1174901283 20:54503849-54503871 AAACTGCAGCCTATGAAGATGGG + Intronic
1175706549 20:61182599-61182621 AAGCTGCAGCCTCTGTAGGTTGG + Intergenic
1177227804 21:18280278-18280300 AAACTTCATCCTATGAAGGCCGG + Intronic
1180669256 22:17540612-17540634 AAACAGCAGCCCATGGAGAATGG + Exonic
1182050336 22:27308259-27308281 AAAATGAATCCTATGGAGATGGG - Intergenic
1183023163 22:35043562-35043584 GAACTGCAGCCCATGAGGAGAGG - Intergenic
1185205043 22:49533103-49533125 AAAGTGCAGCAGATGAAGCTGGG + Intronic
949843320 3:8343902-8343924 ATACTGCAGGCTGTGAAGAGTGG - Intergenic
950511757 3:13433355-13433377 AAGGTGTAGGCTATGAAGATGGG - Intergenic
951054165 3:18127982-18128004 AAACTGAAGCCCATGAACTTGGG + Intronic
958651810 3:96946085-96946107 AAAATGTAGCCTCTTAAGATTGG + Intronic
959770193 3:110085698-110085720 AAAGTGCTGTCTATGAAGAAAGG + Intergenic
959929348 3:111961999-111962021 AAACATCTGCCTATGAAGCTTGG - Intronic
960361001 3:116711052-116711074 AAAATGCAGGTTTTGAAGATGGG - Intronic
967395258 3:189001442-189001464 AAGGTTCAGCCTATGAAGAAAGG - Intronic
967441038 3:189509310-189509332 CAACTCCAGCCTACGAAGAAAGG + Intergenic
967626758 3:191695181-191695203 AACCTGCAACCTAGGAAGACAGG + Intergenic
971275873 4:25196031-25196053 AAACTGGAGGCTGTGAGGATGGG - Intronic
971692323 4:29852728-29852750 AAACTGTAGCCTGTGGAAATTGG - Intergenic
972059756 4:34854711-34854733 AAGCTGCATCCTTTGAATATAGG + Intergenic
974294445 4:59979002-59979024 AAACTGCCTCTAATGAAGATCGG + Intergenic
974974260 4:68870650-68870672 CAGCTGCAGCTTTTGAAGATGGG - Intergenic
977121353 4:93105691-93105713 AGACTGCTGGCTTTGAAGATGGG - Intronic
979092018 4:116495341-116495363 AAACTGGAACTTTTGAAGATGGG + Intergenic
981196243 4:141924455-141924477 TATCTATAGCCTATGAAGATGGG + Intergenic
986772324 5:10985541-10985563 AAAATGCAGCCTATGAGGGCTGG - Intronic
987118735 5:14746874-14746896 CAAGTGTAGGCTATGAAGATGGG + Intronic
987246181 5:16051293-16051315 AAACTGTACCCTTTGAAGAGAGG - Intergenic
990652836 5:57922067-57922089 AAATTGAAGATTATGAAGATAGG - Intergenic
990800611 5:59598652-59598674 GACCTGCAGTCTATGAAGAGAGG - Intronic
991094094 5:62721012-62721034 GAACTGAAGCCTATGAAGCCAGG - Intergenic
992007799 5:72495495-72495517 AAACGGCAGCCTAGAAAGCTAGG - Intronic
992238687 5:74741600-74741622 AATCTGCAACCTATAAAGAAAGG + Exonic
993422011 5:87714419-87714441 AAGGTGTAGGCTATGAAGATGGG + Intergenic
994530715 5:100966736-100966758 AAACTGAAGCCTAGTAACATGGG + Intergenic
995388622 5:111615256-111615278 CACCTGCAGCCAATGCAGATGGG + Intergenic
996396597 5:123019843-123019865 AAACTGATGACTATGAAAATAGG - Intronic
997800500 5:136856193-136856215 AAACTGCACCACATGAAGAATGG + Intergenic
1000305206 5:159988177-159988199 ACACTGCTGACTTTGAAGATGGG + Intergenic
1004054892 6:12125677-12125699 AAACTTCAGCCTATACTGATTGG + Exonic
1005290583 6:24375073-24375095 AAGCTGCAGCAGATGAAGAGTGG - Intergenic
1005891740 6:30146072-30146094 AAACTGCAGGCTCTGCAGGTGGG + Exonic
1008403010 6:51085951-51085973 ATACTTCAGATTATGAAGATGGG + Intergenic
1008466228 6:51833899-51833921 AAACTGGAGCCCATGAATTTTGG + Intronic
1010336469 6:74690201-74690223 AAACTCCAGCCACTGAAGTTAGG - Intergenic
1010549729 6:77206561-77206583 AAACTGAAGAGGATGAAGATGGG - Intergenic
1010646083 6:78389208-78389230 ATACTGCTGGCTTTGAAGATGGG - Intergenic
1011185130 6:84666249-84666271 AAACTGCTGCCTATAAAACTGGG - Intergenic
1013382995 6:109596113-109596135 TAGCTGCAGCCAATGCAGATGGG + Intronic
1013943833 6:115698295-115698317 ATTCTGCAGCCTATGAATAAAGG + Intergenic
1015388764 6:132656125-132656147 AAACTGCAGCCTCTGGAGGCTGG - Intergenic
1017122222 6:151035029-151035051 GGAGTGCAGCCTATAAAGATGGG + Intronic
1017646346 6:156543037-156543059 AAAGTGGAGCCCGTGAAGATGGG - Intergenic
1018031799 6:159847059-159847081 TAACTGCAGTGTATGAACATTGG + Intergenic
1020114412 7:5467789-5467811 AAACAGCAGCCTAAGGAGATGGG + Intronic
1020578679 7:9967563-9967585 AAACTTCAGCCTATATATATTGG - Intergenic
1021321050 7:19211948-19211970 AAACTGGAGACTAGGAAGATAGG - Intergenic
1023800715 7:43832106-43832128 AAGGTGTAGGCTATGAAGATGGG - Intergenic
1024472660 7:49779195-49779217 AAAGAGAAGCCTATGAAGACAGG - Intronic
1026288414 7:68984329-68984351 AAGCTGGTGCCTTTGAAGATGGG - Intergenic
1028580207 7:92401922-92401944 ATAATTCAGCCTATGAACATTGG - Intergenic
1032978240 7:137250515-137250537 AAACTTCAGCATATGAATTTGGG + Intronic
1034339933 7:150346380-150346402 AAACTGGAGGCAGTGAAGATGGG + Intergenic
1035454649 7:159000050-159000072 AAAATGCCACCTCTGAAGATTGG - Intergenic
1037022928 8:13996250-13996272 ATACTGCATCTTATGAAGATGGG - Intergenic
1037684838 8:21129872-21129894 CAAATGCACCCTATGCAGATCGG - Intergenic
1038559131 8:28554845-28554867 AAACTCCAGCATGTTAAGATTGG - Intronic
1040021851 8:42747862-42747884 GAACTGCATCCCAGGAAGATGGG - Intergenic
1041381364 8:57257686-57257708 AATCTGCAGCCAATGGGGATAGG - Intergenic
1043723095 8:83572695-83572717 AAACTGGAGTGTATGAGGATAGG + Intergenic
1044967458 8:97586865-97586887 AAAGTGCAGACCAGGAAGATAGG + Intergenic
1045143697 8:99315375-99315397 AAAATCCAGCACATGAAGATAGG - Intronic
1045809059 8:106200512-106200534 CACATCCAGCCTATGAAGATGGG + Intergenic
1049171761 8:141165888-141165910 AAACAGCAGGCTTTGAGGATGGG - Intronic
1049278149 8:141730212-141730234 CAGCTGCAGCCCTTGAAGATGGG + Intergenic
1049579445 8:143404684-143404706 AAAATGCAGCCAACCAAGATTGG - Intergenic
1050423273 9:5489134-5489156 CAGCTGTAGCCTATGAAGAAAGG + Intergenic
1053683610 9:40501183-40501205 GGAGTGCAGCCTATAAAGATGGG + Intergenic
1054280104 9:63123738-63123760 GGAGTGCAGCCTATAAAGATGGG - Intergenic
1054296713 9:63336680-63336702 GGAGTGCAGCCTATAAAGATGGG + Intergenic
1054394730 9:64641186-64641208 GGAGTGCAGCCTATAAAGATGGG + Intergenic
1054429378 9:65146386-65146408 GGAGTGCAGCCTATAAAGATGGG + Intergenic
1054501003 9:65875145-65875167 GGAGTGCAGCCTATAAAGATGGG - Intergenic
1055410984 9:76029011-76029033 AAAGTGCGGCCTATGAAGATGGG + Intronic
1056100213 9:83293709-83293731 AAACAGGAGCCTATGAATGTAGG - Intronic
1059690831 9:116684753-116684775 AAAGTGTAGGGTATGAAGATGGG - Intronic
1059726619 9:117014623-117014645 GAACTGCAGCATATGAATTTGGG - Intronic
1186155760 X:6724821-6724843 AAACTGCAGCTTATCAATATGGG + Intergenic
1187340379 X:18415930-18415952 AAAATGTAGCTTATGATGATTGG + Intergenic
1189532285 X:41898188-41898210 AAAATACAGCCTATCAAGACTGG - Intronic
1194686403 X:96923163-96923185 TAACAGCAGCCTGTGAAGACTGG - Intronic
1196379366 X:115072063-115072085 AATCTGCAACCAAAGAAGATGGG - Intergenic
1196569080 X:117244639-117244661 AAACTGCAGCATAAGGAGTTAGG + Intergenic
1198534871 X:137575302-137575324 AAACGTGAGCCTATGAAAATTGG + Intronic
1199893143 X:152108020-152108042 AAACTCCAGTCCATGAACATGGG - Intergenic