ID: 1174902615

View in Genome Browser
Species Human (GRCh38)
Location 20:54516292-54516314
Sequence GGGTTGTTTTATTCAAATTG GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 234
Summary {0: 1, 1: 0, 2: 1, 3: 15, 4: 217}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1174902615 Original CRISPR GGGTTGTTTTATTCAAATTG GGG Intronic
902153404 1:14463105-14463127 GGGTGGGTTAATGCAAATTGAGG + Intergenic
902260117 1:15218834-15218856 GGGTGGGTTAATGCAAATTGAGG - Intronic
905764939 1:40592499-40592521 GGGTGGGTTAATGCAAATTGAGG - Intergenic
909367997 1:74850711-74850733 GGGTTTTTTTTTTTTAATTGAGG - Intergenic
910139110 1:84006902-84006924 GACTTGTCTTATTCAAATGGAGG - Intergenic
910602781 1:89049792-89049814 GAGTTGTTTGATTCAATTTTAGG - Intergenic
910637932 1:89429451-89429473 GAGTTGTTTGATTCAATTTTAGG + Intergenic
911604849 1:99892918-99892940 GGGTTTATTTTTTAAAATTGGGG - Intronic
912533945 1:110349471-110349493 GGGTTGTTTTACTGAAATCAGGG - Intergenic
912592043 1:110832840-110832862 GTTTTGTTTTATTCAGATTTAGG - Intergenic
913002781 1:114597918-114597940 GCGTAGTGTTATTCATATTGTGG - Intronic
918891863 1:190283382-190283404 CGGTTGTTTTATTCAAAGTATGG - Intronic
921143180 1:212325433-212325455 GGCTGGTTTCATTCACATTGAGG + Intronic
922990241 1:229901310-229901332 TGGTGGTTTTCTTCATATTGTGG - Intergenic
924102564 1:240619838-240619860 GGATTGTTTTATTTTAATTCTGG - Intergenic
1063309069 10:4935986-4936008 TTTTTGTTTTATTGAAATTGGGG + Intronic
1064032469 10:11891656-11891678 TGGTTATTTCATTCAAACTGAGG - Intergenic
1064471376 10:15639356-15639378 GGGTGGTTTTGCTCAAAGTGGGG + Intronic
1067729407 10:48799175-48799197 GGGTAGTTTTATTCAGGGTGGGG - Intronic
1067970201 10:50961055-50961077 GGGTTTTTTTAATTAAAGTGGGG + Intergenic
1070442155 10:76456964-76456986 GTGTTGGTTTTTTCAAATTGTGG + Intronic
1071100137 10:82027282-82027304 GTGTTCTTCTATTCAAATTATGG + Intronic
1071273670 10:84032183-84032205 GAGTTGTTTTATTGAAATGCTGG - Intergenic
1072191225 10:93078065-93078087 GGTTTTCTTTATTCAAAATGAGG + Intergenic
1079114548 11:17632884-17632906 GGGTCGTGTTCTTCAAACTGTGG + Intronic
1079942387 11:26697728-26697750 GGGTCGTTTTCTTCAATCTGAGG + Intronic
1079953802 11:26837637-26837659 GGGTTATTGTATTCAAAATGTGG - Intergenic
1080065980 11:28013854-28013876 GAGATGTTTTAATCAAATTCAGG + Intergenic
1087359492 11:97140277-97140299 GGAATGTTATATTCAAAGTGTGG - Intergenic
1088153063 11:106771252-106771274 TGGTTATTTTAATCAAAGTGTGG + Intronic
1089786974 11:120914761-120914783 TGTTTGTTTTATTCAAAGAGGGG + Intronic
1093851414 12:24044104-24044126 GTGTAGTATTATTCAAATTGTGG - Intergenic
1094046148 12:26169022-26169044 GTGTTTTTTTTTTCAAAATGAGG - Intronic
1094644397 12:32307449-32307471 GGGCTTATTTATACAAATTGTGG + Intronic
1095792535 12:46183149-46183171 GGGTTTTTTTTTTCAGAGTGTGG - Intronic
1095920993 12:47531113-47531135 GGGATGATATATTCAAATTGCGG - Intergenic
1096017051 12:48286133-48286155 GGGTGGTTTAATGCAAATTGAGG + Intergenic
1100148443 12:91706490-91706512 GGGTTGATGTTTTCAAATTTGGG - Intergenic
1100969342 12:100050870-100050892 AATTTGTTTTATTCATATTGAGG - Intronic
1102937927 12:116912895-116912917 GGATTGTTATATTCGAATTAGGG - Intronic
1105796262 13:23856509-23856531 GGGTGGGTTAATGCAAATTGGGG + Intronic
1109570480 13:64182384-64182406 GAGTTTTTTTATTGAAAATGAGG - Intergenic
1110129634 13:71991042-71991064 GGCTTGCTTCATTCAAATCGTGG - Intergenic
1110197825 13:72811164-72811186 GGGTTGTTTATTAAAAATTGAGG - Intronic
1110682447 13:78331957-78331979 GGGTTTTTTTTTTCTAATTTGGG + Intergenic
1110889843 13:80685097-80685119 GAGTTAATTTATTTAAATTGAGG + Intergenic
1111663843 13:91243233-91243255 GGGTAGGTTGATACAAATTGAGG + Intergenic
1111924532 13:94448433-94448455 AGGTAGTTTTGTTAAAATTGTGG + Intronic
1113052963 13:106235026-106235048 AGGCTGCTTTATTCATATTGGGG - Intergenic
1116260476 14:42618455-42618477 GTTTTGTTTTATCCAAATAGGGG - Intergenic
1116575305 14:46567034-46567056 GGGTTGTTTTATTACAATGTAGG + Intergenic
1118144916 14:63124798-63124820 GGCTTCATTTATACAAATTGGGG - Intergenic
1119078706 14:71671641-71671663 GGGTAGTTTTATTAACATTGAGG + Exonic
1123402290 15:19999608-19999630 GGGTGGTTTTCCTAAAATTGTGG + Intergenic
1123511630 15:21006274-21006296 GGGTGGTTTTCCTAAAATTGTGG + Intergenic
1123965446 15:25451336-25451358 GGTTTATTTTTTTCAAATAGAGG - Intergenic
1126616585 15:50588333-50588355 TGGTTATTATATGCAAATTGAGG - Intronic
1126880705 15:53093206-53093228 GGATTTTCTTATTCCAATTGGGG - Intergenic
1127546493 15:59998159-59998181 GGGTTTTTTTTTTTAAAGTGGGG - Intergenic
1128630868 15:69265487-69265509 TGGTTGGTTAATTTAAATTGAGG + Intronic
1132160514 15:99537104-99537126 GGGTTGTTTTATTCTATTTTTGG + Intergenic
1133905600 16:10019598-10019620 GGGTTGATTTAATCTACTTGAGG - Intronic
1139087138 16:63600688-63600710 AGGATTTTTTATTCAAAATGTGG + Intergenic
1140296092 16:73711117-73711139 GGGTTGTTTTATTTAACTGAAGG + Intergenic
1142158017 16:88541555-88541577 GGGTGGGTTAATGCAAATTGAGG + Intergenic
1144150583 17:12439562-12439584 GTGTTGTTTTATCCAATTCGGGG - Intergenic
1144424856 17:15132285-15132307 GGGTGGGTCAATTCAAATTGAGG - Intergenic
1144585952 17:16487903-16487925 GGGTTGGTTTACTCGAAGTGTGG - Intronic
1144756773 17:17684422-17684444 GGCTTGTTTTTTTCAAATTCTGG - Intronic
1145181580 17:20757718-20757740 AGCTTGATTTAATCAAATTGTGG - Intergenic
1148922362 17:51049942-51049964 GGATTGATTTGTTCAAATGGAGG + Intronic
1148957405 17:51365179-51365201 GGGTTGTTGTTTTCTAACTGGGG + Intergenic
1150153210 17:62828140-62828162 TTGTTGTTTTAATTAAATTGGGG - Intergenic
1151144285 17:72026197-72026219 CTGATGTTTTACTCAAATTGAGG - Intergenic
1152075324 17:78155956-78155978 GGGTTGTATTATACCAATGGCGG - Intronic
1152978145 18:244367-244389 GAGTAGTTTTTTTCAAAATGAGG + Intronic
1154039626 18:10841531-10841553 GAGTTGATTTATTCAATGTGAGG + Intronic
1156018041 18:32568280-32568302 GGATTTTTTTACTCAAACTGGGG - Intergenic
1156189989 18:34707733-34707755 GGTATGAATTATTCAAATTGGGG + Intronic
1156457940 18:37305177-37305199 GGGGTAATTTATTCAAATTGCGG + Intronic
1157023751 18:43817680-43817702 GGGTTGTTTTGTGTAACTTGTGG + Intergenic
1157057427 18:44247224-44247246 TAGTTGTTTTATGAAAATTGAGG + Intergenic
1157803165 18:50637426-50637448 GGGTTCTTTGGTTCAAATTCTGG - Intronic
1158382834 18:56953405-56953427 GGCTTGTTTTTTTCTAATTTTGG - Intronic
1158839631 18:61370569-61370591 GAGTTGTTTTAATCAGTTTGTGG - Intronic
1159271453 18:66157644-66157666 GGATTTTTTTGATCAAATTGAGG - Intergenic
1159711789 18:71768823-71768845 GAGTAGTTTTACTCATATTGTGG - Intronic
1168531700 19:57135016-57135038 GGGTTTTTTTATGCAAACTAAGG + Exonic
926528822 2:14016453-14016475 GGGATGTTTGATTCAATTTCTGG - Intergenic
931737273 2:65207732-65207754 TAGTTGGTTTATTCAAATTCAGG + Intergenic
932749599 2:74362955-74362977 GGGCAGTTTTATTCATCTTGGGG + Intronic
932836776 2:75045506-75045528 AAGATGTTTTATTTAAATTGAGG - Intergenic
933063169 2:77763688-77763710 GGGTTTCTACATTCAAATTGAGG + Intergenic
933527012 2:83454257-83454279 TTGTTGTTCTAGTCAAATTGAGG + Intergenic
934909487 2:98237844-98237866 GGTTTGCTTTATTGTAATTGGGG + Intronic
937899571 2:127008038-127008060 GGGATTTGTTATTCAGATTGAGG - Intergenic
938401781 2:130999122-130999144 GAGTTGTTTTCTTATAATTGAGG + Intronic
938410348 2:131058613-131058635 AAGTTGTTGTATTCAAATTTTGG - Intronic
938622209 2:133067917-133067939 TGGTTGTATTATCCCAATTGAGG - Intronic
939181219 2:138804547-138804569 GGATTGGGTTCTTCAAATTGTGG + Intergenic
939322170 2:140638361-140638383 GGCTTGTCTTTTTTAAATTGGGG - Intronic
939653844 2:144797731-144797753 AGATTGTTTTTTTCAAACTGAGG + Intergenic
940546287 2:155090916-155090938 GTGTTGTTTTATTTAAAGTCAGG + Intergenic
940758620 2:157712193-157712215 TGGTTGTTCAATTCAAATTTTGG + Intergenic
940844030 2:158620315-158620337 GGTTTGTTTTTTTCAAGTTCAGG + Intronic
941380139 2:164782689-164782711 GGCTGTTTTTATTAAAATTGTGG - Intronic
945562368 2:211354585-211354607 GGGTTTTTTTGTTCATATTCTGG - Intergenic
946075064 2:217066986-217067008 GGGTTGTACCAGTCAAATTGTGG - Intergenic
947275927 2:228391909-228391931 TGTTTGTTTTATTGAAATTCTGG + Intergenic
1169579810 20:7007918-7007940 AGATTTTTTTTTTCAAATTGAGG + Intergenic
1169654589 20:7908827-7908849 GGTTAGCTTTATTCAAATTAGGG - Intronic
1170440068 20:16370062-16370084 GGGTTGATTTTTTAAAATTTAGG + Intronic
1173777449 20:45722436-45722458 GGGTGGTGTTAATAAAATTGCGG + Exonic
1174902615 20:54516292-54516314 GGGTTGTTTTATTCAAATTGGGG + Intronic
1175481662 20:59315549-59315571 GCGTTGTTTCATTTAAATAGAGG - Intronic
1176856196 21:13974885-13974907 GTGTTGTTTTATGCTAATTAGGG + Intergenic
1177269619 21:18830324-18830346 GGGTGGTTTTATTCCAGTGGTGG + Intergenic
1177468236 21:21518562-21518584 TAGTTGTTTTATTTAAATAGAGG + Intronic
1178844613 21:36164154-36164176 TGGCTGTTTTATTTAAAGTGTGG - Intronic
1180518978 22:16176443-16176465 GTATTGTTTTATTCAATTTTTGG + Intergenic
1180963178 22:19771762-19771784 GTGTTCTCTTATTCAAAGTGGGG + Intronic
949778674 3:7661218-7661240 GGGTTTTTTGATTCAAATATAGG - Intronic
950617578 3:14173699-14173721 TGCTGGTTTTAGTCAAATTGGGG + Intronic
951170108 3:19532046-19532068 GATTTGTATTCTTCAAATTGAGG - Intronic
951665327 3:25116983-25117005 AGGTTGTTTCATTAAATTTGTGG + Intergenic
951950028 3:28189882-28189904 GGGTTCTTTTATTGCAATGGGGG + Intergenic
952008389 3:28869877-28869899 GGTTTTCTTTATTCAAAGTGTGG - Intergenic
955568997 3:60282924-60282946 TGGTTGTTGTATTCACCTTGGGG - Intronic
957784286 3:84861179-84861201 GTGTTGTTGTTTTCAAATTAAGG + Intergenic
957936017 3:86943948-86943970 GAGTGGTTTTAATAAAATTGTGG + Exonic
958494854 3:94831384-94831406 GGGTAGTTTTGTTTAAATGGTGG + Intergenic
958724748 3:97890966-97890988 TGGATATTTGATTCAAATTGAGG - Intronic
958937660 3:100274397-100274419 GAGTTGATTTTTTTAAATTGTGG + Intronic
960625733 3:119680304-119680326 TGGTTGTTTTTTTCAAAGTCAGG - Intergenic
960762570 3:121090073-121090095 GCCTTTTTTCATTCAAATTGAGG + Intronic
965822187 3:172695621-172695643 GGGTTAATGTATTCAAATCGTGG + Intronic
966019695 3:175192885-175192907 GGGTTTTTTTTATCATATTGTGG - Intronic
966811136 3:183845953-183845975 TTGGTGTTTTATTCTAATTGTGG + Intronic
970352737 4:15220371-15220393 TGTTTGTTTTATTCTTATTGAGG - Intergenic
970614486 4:17755174-17755196 TGATACTTTTATTCAAATTGAGG - Intronic
971286888 4:25299349-25299371 GGGTTGTTTTGTGAAAAATGTGG + Intergenic
974169621 4:58249620-58249642 GAGTTATTTAATTCAAAATGTGG + Intergenic
974360435 4:60871309-60871331 AGTTTGTTTTATTCTATTTGTGG - Intergenic
977739098 4:100455700-100455722 GTGTAGTTTTCTTCAACTTGGGG + Intronic
979587047 4:122432800-122432822 GGGTGGTATTTTTCAAAGTGTGG - Intergenic
980480239 4:133378365-133378387 GCTTTGTTTTATACATATTGGGG + Intergenic
981754354 4:148125002-148125024 CAGATGTTTTATTCAAATTTGGG + Intronic
982433012 4:155344988-155345010 GGAATGTTTAATTCAAATTAAGG - Exonic
983595270 4:169459036-169459058 GGGTTTTTTTTTTCAGATTTTGG - Intronic
983939656 4:173526107-173526129 GGGGTGTTTAATTCAAACTATGG - Exonic
985982574 5:3483321-3483343 TGGTCGCTTTATTCAAATTTTGG - Intergenic
986832230 5:11592659-11592681 TTGTTGTTTTGATCAAATTGAGG - Intronic
987404565 5:17511911-17511933 GGGTTGTTGTCTTTAAATAGGGG + Intergenic
988517124 5:31914756-31914778 GTGGTGTTCTATTGAAATTGAGG + Intronic
990030007 5:51246995-51247017 GGGTTGTTTTGCTCATAGTGTGG + Intergenic
994294867 5:98078960-98078982 GGGATGTTTTATACAAAGGGTGG - Intergenic
994754105 5:103773730-103773752 GTGTAGTATTAATCAAATTGAGG + Intergenic
997315017 5:132925540-132925562 GTGTTGTTTTGTTTGAATTGTGG - Intronic
997995564 5:138583159-138583181 TGCTTGTTTTATTCAACTAGTGG + Intergenic
998418314 5:141961311-141961333 TGTTTGTTTTATTCACACTGGGG + Intronic
998568570 5:143237511-143237533 GGATTGTTTTTTTCAATTTGTGG + Intergenic
1001387777 5:171354041-171354063 TGGTTTTTTTATTCAATCTGGGG + Intergenic
1004186062 6:13422260-13422282 GGGTTCTTTTACTCCACTTGGGG - Intronic
1006590781 6:35155041-35155063 GGGTTGTTTTGTTTTAATTGTGG + Intergenic
1006722327 6:36164517-36164539 GAGTTATTTTACTCAAATTAGGG + Intergenic
1007054584 6:38869685-38869707 CGGATATTTTATTTAAATTGGGG - Intronic
1007886393 6:45235226-45235248 GGGCTATTTTATTTAAAATGTGG - Intronic
1007913949 6:45543153-45543175 GGTTGGTTTTACTCAACTTGGGG - Intronic
1008824480 6:55676747-55676769 GGGTTCTTTTATGGAAACTGTGG - Intergenic
1010675913 6:78742752-78742774 GGGTGGGTTAATGCAAATTGAGG - Intergenic
1011685294 6:89819185-89819207 GGTTTGTTTTTCTGAAATTGAGG - Intronic
1012133782 6:95529526-95529548 GGGTAGTTTTATTAAAAGAGAGG + Intergenic
1012685164 6:102237743-102237765 GGGTTGTTTTATTCTGATTTGGG + Intergenic
1012751048 6:103164190-103164212 GGAGTGATTTATTCACATTGGGG - Intergenic
1012992931 6:105944986-105945008 GGGGATTTTTATTCAAATCGTGG + Intergenic
1013554127 6:111239192-111239214 GGGTTTTTTTTTTTGAATTGTGG + Intergenic
1013982320 6:116146440-116146462 GAGTTGCTTTACTCAAAATGGGG + Intronic
1014245095 6:119059282-119059304 TTGTTGTTTTATACAAATTTTGG + Intronic
1014889871 6:126830876-126830898 GGGTTGTTTTTTCCTTATTGTGG + Intergenic
1015821825 6:137269494-137269516 CGGATGTTTTTTACAAATTGAGG - Intergenic
1019697711 7:2456120-2456142 ATGTTGTTTTAATCAAATTTGGG + Intergenic
1021167314 7:17357137-17357159 GGGTAGTCTTCTTCAAATTAAGG - Intergenic
1022918000 7:34980589-34980611 GGGTTATTTTATTCATATATGGG - Intronic
1023286148 7:38622559-38622581 GGGTAGTGTTTTTCAAATTGTGG + Intronic
1023614480 7:42006043-42006065 GGGATGATATATTCAAATTAGGG - Intronic
1023615899 7:42019072-42019094 GGGTTGGATTGTTGAAATTGAGG + Intronic
1024336272 7:48209545-48209567 TTGTTGGTTTATTCAAATTTTGG + Intronic
1024747671 7:52427161-52427183 GGGTGGGTTAATGCAAATTGAGG - Intergenic
1027660076 7:80978371-80978393 GTTTTGTTTTTTTTAAATTGTGG - Intergenic
1028721918 7:94042709-94042731 GGGTTGTTTTATTCAAATGATGG + Intergenic
1029385551 7:100241206-100241228 GGGGTGTTTCTTTCAAAGTGTGG + Intronic
1029426474 7:100497503-100497525 GTTTTGTTTTTTTCAAGTTGGGG - Intergenic
1030536690 7:110776059-110776081 GAATTATTTTATTCAAATTACGG - Intronic
1030757759 7:113309661-113309683 GGGTTTTTTCCTTCAAATTCTGG + Intergenic
1030943941 7:115692610-115692632 GGGTTGTTTTAGTCACTTTTAGG + Intergenic
1031579781 7:123458150-123458172 TGGTTGTTTTAATCAAAAAGAGG + Intronic
1033537073 7:142321918-142321940 GGTTTGCTTTATACAACTTGGGG + Intergenic
1036202108 8:6778513-6778535 AGGTTGTGTTATTTAAGTTGGGG + Intergenic
1039219716 8:35316150-35316172 GTATTGTTTTATTTAAATTAAGG + Intronic
1042153817 8:65819712-65819734 GATTAATTTTATTCAAATTGTGG + Intronic
1042439087 8:68804256-68804278 GGGGTATTTTATTTTAATTGAGG - Intronic
1043844266 8:85146511-85146533 GGGTATTTTAAATCAAATTGAGG - Intergenic
1046099140 8:109594413-109594435 TGGGTGTTTTATTCCATTTGTGG - Intronic
1046556419 8:115778963-115778985 GTGTTGTTTTATTCACAATTTGG + Intronic
1050827225 9:9962875-9962897 CAGTTGTTTTATTCAAGTTATGG - Intronic
1051208686 9:14718169-14718191 GATCTGTTTTATTCAAATTTTGG - Intergenic
1052245434 9:26328603-26328625 GGGGTGGTTAATTCAAATTTGGG - Intergenic
1054947502 9:70811193-70811215 CGCTTGTTTTATTCATTTTGGGG - Intronic
1059382985 9:113942994-113943016 GGGTTGGTTTCATCAAGTTGAGG + Intronic
1061548994 9:131321832-131321854 GTTTTGTTTTGTTTAAATTGAGG + Intergenic
1188354494 X:29174699-29174721 AGGTTGATTTATTTAAATTGCGG + Intronic
1190389328 X:49916430-49916452 AGGTGGTATTATTCAAAGTGTGG + Intergenic
1191875718 X:65793976-65793998 GTCTTTTCTTATTCAAATTGTGG + Intergenic
1194531331 X:95053116-95053138 GGGTTGTTTTCTTGGTATTGAGG - Intergenic
1195373931 X:104207065-104207087 GGGTGGGTTAATGCAAATTGAGG + Intergenic
1195726182 X:107919072-107919094 GGGTTGTTTTGTTAGAAGTGAGG - Intronic
1197364968 X:125552872-125552894 GGGTTTCTTTCTACAAATTGTGG - Intergenic
1197613639 X:128666889-128666911 TGGTTATTGTATGCAAATTGAGG - Intergenic
1198568197 X:137926988-137927010 AGGTGGTTTTTGTCAAATTGAGG + Intergenic
1198636633 X:138709368-138709390 GAGATTATTTATTCAAATTGTGG - Intronic
1200181613 X:154154467-154154489 GGGTTTGTTTTTTTAAATTGAGG - Intronic
1200187261 X:154191581-154191603 GGGTTTGTTTTTTTAAATTGAGG - Intergenic
1200192910 X:154228721-154228743 GGGTTTGTTTTTTTAAATTGAGG - Intronic
1200198665 X:154266525-154266547 GGGTTTGTTTTTTTAAATTGAGG - Intronic
1200832597 Y:7701996-7702018 AGGTTGTTTTGTTAAAAGTGTGG + Intergenic
1200865985 Y:8043925-8043947 GGTTTGTTTTATCCACATTTGGG + Intergenic
1200914622 Y:8560551-8560573 AGGTTGCTCTATTCAAAGTGAGG + Intergenic
1201864533 Y:18635244-18635266 GGTTTTATTTAATCAAATTGGGG + Intergenic
1201868789 Y:18685134-18685156 GGTTTTATTTAATCAAATTGGGG - Intergenic
1202114363 Y:21456170-21456192 AGGGTGTTTTATTAAAAGTGTGG - Intergenic
1202162526 Y:21950554-21950576 AGGTTGTTTTGTTAAAAATGCGG + Intergenic
1202228830 Y:22635814-22635836 AGGTTGTTTTGTTAAAAATGCGG - Intergenic
1202314326 Y:23560353-23560375 AGGTTGTTTTGTTAAAAATGCGG + Intergenic
1202556476 Y:26110242-26110264 AGGTTGTTTTGTTAAAAATGCGG - Intergenic