ID: 1174904137

View in Genome Browser
Species Human (GRCh38)
Location 20:54532362-54532384
Sequence TTCTGTGTTTATAGAGAAGA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 1618
Summary {0: 1, 1: 0, 2: 5, 3: 51, 4: 1561}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1174904134_1174904137 21 Left 1174904134 20:54532318-54532340 CCTGAGGTTGTGTTCTTGACTTT 0: 1
1: 0
2: 0
3: 22
4: 215
Right 1174904137 20:54532362-54532384 TTCTGTGTTTATAGAGAAGAAGG 0: 1
1: 0
2: 5
3: 51
4: 1561

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1174904137 Original CRISPR TTCTGTGTTTATAGAGAAGA AGG Intronic
900682995 1:3928045-3928067 TTCCGTGTTCAGAGAGAATAGGG + Intergenic
901036833 1:6341310-6341332 TTCTGTATTTTTAGTAAAGACGG + Intronic
901376315 1:8842196-8842218 TTCTGTATTTTTAGTGGAGATGG + Intergenic
901588721 1:10320869-10320891 TTTTGTGTTTTTAGTGGAGATGG + Intronic
901603093 1:10437625-10437647 TTTTGTGTTTTTAGTAAAGACGG + Intronic
901670365 1:10852438-10852460 TGCTGTGTTTTAAGAGAGGAGGG + Intergenic
902105037 1:14027972-14027994 TTCTGTCTTTGTAGAGATGGTGG + Intergenic
902152628 1:14456675-14456697 TGCTTTGTTTGTGGAGAAGAAGG - Intergenic
902262983 1:15240784-15240806 TTTTGTGTTTTTAGTGGAGAAGG - Intergenic
903000103 1:20259160-20259182 TATTGTGATTATGGAGAAGAAGG + Intergenic
903072824 1:20735892-20735914 TTCTGGGATTTTAGAGAAAAGGG - Intergenic
903511510 1:23879121-23879143 TTTTGTGTTTTTAGTAAAGATGG - Intronic
903759540 1:25688398-25688420 AACTGTGTTTAGAGAGAAGGAGG - Intronic
903941481 1:26934827-26934849 TTTTGTGTTTTTAGTAAAGACGG + Intronic
904126471 1:28243593-28243615 TTTTGTATTTTTAGTGAAGATGG + Intronic
904226866 1:29028523-29028545 TTCTCGTTTTATAGAGGAGATGG + Intronic
904502028 1:30918740-30918762 TTTTGTATTTTTAGAAAAGATGG + Intergenic
904841783 1:33376756-33376778 TTTTGTATTTATAGTAAAGATGG - Intronic
905169782 1:36102841-36102863 TTTTGTATTTATAGTAAAGATGG + Intronic
905193666 1:36256965-36256987 TTTTGTGTTTTTAGTAAAGACGG + Intronic
905373738 1:37503476-37503498 TTTTGTTTTTATAGAGATGAGGG - Intronic
905557748 1:38900448-38900470 TTTTGTGTTTTTAGTGGAGATGG - Intronic
905777369 1:40677524-40677546 TTTTGTATTTTTAGTGAAGACGG - Intergenic
905868377 1:41388723-41388745 ATCTGTGTTTACAGAGAGGCAGG + Intergenic
905950123 1:41943561-41943583 TTGTCTGTGTGTAGAGAAGATGG - Intronic
906043281 1:42806069-42806091 TTTTGTGTTTTCAGAGAAGTAGG - Intergenic
906121227 1:43392584-43392606 TTTTGTGTTTTTAGTAAAGACGG + Intronic
906307641 1:44730152-44730174 TTTTGTGTTTTTAGTAAAGACGG + Intergenic
906404011 1:45527209-45527231 TTTTGTGTTTTTAGTGGAGACGG - Intergenic
906619601 1:47265063-47265085 TTTTGTATTTTTAGTGAAGACGG - Intronic
906897108 1:49787328-49787350 TTCTGTATTTTTAGTGGAGACGG - Intronic
906977139 1:50588114-50588136 TTTTGTGTTTTTAGTGGAGATGG - Intronic
907006740 1:50921994-50922016 TTTTGTGTTTTTAGTGGAGACGG - Intronic
907109389 1:51913054-51913076 TTCAGTATATATAGAAAAGATGG - Exonic
908226526 1:62061350-62061372 TTTTGTATTTTTAGTGAAGACGG + Intronic
908805989 1:67933036-67933058 TTTTGTGTTTTTAGTGGAGATGG + Intergenic
908998490 1:70188560-70188582 TTTTGTGTGTGTAGAGATGAGGG - Intronic
909377571 1:74957571-74957593 TTTTGTGTTTTTAGTGTAGACGG - Intergenic
909562913 1:77025360-77025382 TTTTGTGTTTTTAGTAAAGAGGG - Intronic
909730579 1:78884242-78884264 TTCTGTGTATACAGAGAATGTGG + Intergenic
909949759 1:81705416-81705438 TTTTGTGTTTTTAGTGGAGACGG + Intronic
909962281 1:81861189-81861211 TTCTGTATTTTTAGTAAAGACGG + Intronic
910383396 1:86655781-86655803 TCCTTTGTTTACAGACAAGAAGG + Intergenic
910513360 1:88031098-88031120 TTTTGTATTTTTAGAGGAGACGG - Intergenic
910551132 1:88476539-88476561 TTCTGTATTTTTAGTGGAGATGG - Intergenic
911028371 1:93459102-93459124 TTCTGTATTTTTAGTGGAGACGG - Intronic
911317135 1:96369259-96369281 TTTTGTATTTTTAGAGAAGACGG - Intergenic
911573257 1:99543314-99543336 TTCTGTATTTTTAGTAAAGAGGG + Intergenic
911587046 1:99703585-99703607 TTTTGTATTTTTAGTGAAGACGG - Intergenic
911625287 1:100117121-100117143 TTTTGTATTTTTAGTGAAGACGG - Intronic
911743572 1:101414457-101414479 TTCTGCATTTATTGAGATGAAGG - Intergenic
911786249 1:101951889-101951911 TTCTATCTTTATAAAGAAGGTGG + Intronic
912374142 1:109196851-109196873 TTTTGTGTTTTTAGTAAAGACGG + Intronic
912579632 1:110708479-110708501 TTTTGTGCTTATAGTAAAGATGG + Intergenic
913009033 1:114664648-114664670 TTCTGTGTTTTTAGTAGAGATGG + Intronic
913174866 1:116264057-116264079 TCCAGTGTTTAAAGAGAAAAAGG + Intergenic
913307994 1:117452134-117452156 TTCTGTATTTTTAGTAAAGATGG - Intronic
913355509 1:117916861-117916883 TTTTGTATTTTTAGTGAAGATGG - Intronic
913559053 1:119999709-119999731 TTTTGTATTTTTAGAAAAGATGG - Intronic
913604204 1:120450054-120450076 TTTTGTATTTTTAGTGAAGATGG - Intergenic
913638801 1:120790768-120790790 TTTTGTATTTTTAGAAAAGATGG + Intergenic
914279658 1:146159185-146159207 TTTTGTATTTTTAGAAAAGATGG - Intronic
914540698 1:148610115-148610137 TTTTGTATTTTTAGAAAAGATGG - Intronic
914674383 1:149897306-149897328 TTTTGTGTTTTTAGTGGAGACGG - Intronic
914790007 1:150869303-150869325 TTTTGTGTTTTTAGTGGAGATGG - Intronic
914884022 1:151570450-151570472 TTTTGTGTTTTTAGAAGAGACGG + Intronic
914891269 1:151625662-151625684 TTTTGTGTTTATAGTAGAGACGG - Intronic
915133727 1:153714764-153714786 TTTTGTGTTTTTAGTAAAGATGG + Intergenic
915171292 1:153979376-153979398 TTCTGTATTTTTAGTGGAGACGG - Intergenic
915781113 1:158551798-158551820 TCCTGTGTTTCTAGAGCTGAAGG - Intergenic
915798290 1:158760891-158760913 TTCTATATTTTTAGTGAAGACGG - Intergenic
915854032 1:159361972-159361994 TTCTGTGTTTATAAATAACCAGG - Intergenic
916184871 1:162121296-162121318 TTCTGTATTTTTAGTGGAGACGG + Intronic
916472910 1:165141373-165141395 TTTTGTGTTTTTAGTAAAGACGG - Intergenic
916778322 1:167993577-167993599 TTTTGTGTTTTTAGTAAAGACGG - Intronic
916796655 1:168173661-168173683 TTTTGTGTTTTTAGTAAAGACGG + Intergenic
916950864 1:169778937-169778959 TTTTGTGTTTTTAGTAAAGACGG + Intronic
916976508 1:170086105-170086127 TTTTGTTCTTATAAAGAAGATGG + Intergenic
917023993 1:170621640-170621662 TTTTGTGTTTTTAGTGGAGATGG - Intergenic
918652286 1:186980118-186980140 TTTTGTGTTTGTAGTGAAGACGG + Intronic
918862569 1:189850580-189850602 TCCTGTACTTATAGAGTAGAAGG - Intergenic
919141892 1:193582740-193582762 TTCTGTATTTATGTGGAAGAAGG + Intergenic
919244512 1:194963566-194963588 TTCTGTGTTTTTAGTAGAGACGG + Intergenic
919459917 1:197864363-197864385 GTGTGTGTTTATTGAGAATATGG + Intergenic
919634390 1:199989466-199989488 TTTTGTGTTTTTAGTGGAGATGG - Intergenic
919701777 1:200638635-200638657 TTTTTTTTTTGTAGAGAAGAGGG + Intronic
919710170 1:200718826-200718848 TTTTGTGTTTTTAGTAAAGACGG + Intergenic
919734760 1:200939781-200939803 TTTTGTGTTTTTAGTGAAGATGG + Intergenic
919823426 1:201487240-201487262 TTTTGTATTTTTAGTGAAGATGG - Intronic
919965484 1:202519440-202519462 TTCTGTATTTTTAGTAAAGATGG + Intronic
920047503 1:203142929-203142951 TGTTGTGTTTACAGAGAACAGGG - Intronic
920112902 1:203599526-203599548 TTTTGTGTTTTTAGTGGAGATGG - Intergenic
920282069 1:204851501-204851523 TTTTGTGTTTTTAGTGGAGATGG + Intronic
920820396 1:209374878-209374900 TTTTGTATTTTTAGAAAAGATGG - Intergenic
921022496 1:211248957-211248979 TTTTGTGTTTTTAGAAGAGATGG - Intergenic
921087013 1:211803927-211803949 TTCTGTATTTTTAGTGGAGATGG + Intronic
921555158 1:216589731-216589753 TTTTGTGCTTTTAGTGAAGATGG - Intronic
921556286 1:216601882-216601904 TTCAGTGTTTAAAGATAAGTAGG - Intronic
921622412 1:217340472-217340494 TTTTATTTTTATAGAGATGAGGG + Intergenic
921709040 1:218355071-218355093 TTTTGTGTTTTTAGTCAAGATGG + Intronic
921739243 1:218665170-218665192 TTTTGTGTTTATCATGAAGATGG + Intergenic
922005902 1:221530548-221530570 TTTTGTGTTTTTAGTAAAGATGG + Intergenic
922040725 1:221893716-221893738 TTTTGTGTTTTTAGTGGAGATGG - Intergenic
922247047 1:223809994-223810016 TTCTGTATTTTTAGTGGAGATGG + Intronic
922267696 1:224000520-224000542 ATCTGTCTTTATAAAGGAGATGG + Intergenic
922356516 1:224781437-224781459 TTCTGGGCTTATAGGAAAGAAGG - Intergenic
922374638 1:224949685-224949707 TTATGTGTTTATACAAGAGAGGG - Intronic
922522827 1:226272224-226272246 TTTTGTGTTTTTAGTGGAGACGG + Intronic
922544698 1:226447359-226447381 TTCTCTGTTTATAGATGAGCCGG + Intergenic
922571870 1:226639226-226639248 TTTTGTGTTTTTAGTAAAGATGG + Intronic
922690606 1:227686385-227686407 TTTTGTATTTTTAGTGAAGATGG + Intergenic
923262598 1:232281807-232281829 TTTTGTATTTTTAGAGGAGACGG - Intergenic
923393901 1:233541975-233541997 TTTTGTGTTTTTAGTCAAGACGG + Intergenic
923722829 1:236481939-236481961 TTTTGTGTTTTTAGTAAAGACGG - Intronic
924098167 1:240575689-240575711 TTCTGTATTTATAGTAGAGACGG + Intronic
924236216 1:242001442-242001464 TATTGTATTTATAGTGAAGACGG - Intergenic
924256853 1:242191413-242191435 TTTTGTGTTTATAGTAGAGATGG - Intronic
924304609 1:242674348-242674370 TTTTGTATTTTTAGTGAAGACGG + Intergenic
924380479 1:243459351-243459373 TTCTGCCTCTAAAGAGAAGATGG + Intronic
924521407 1:244809421-244809443 TTCTGTATTTTTAGTAAAGACGG + Intergenic
924843278 1:247737246-247737268 ATATGTGTGTATAGAGAAGGAGG + Intergenic
924866465 1:247986916-247986938 TCCTGTATTTATAGATTAGAAGG - Intronic
924870221 1:248034590-248034612 TTCTGTATTTATAGACTGGAAGG - Intronic
1062859863 10:802997-803019 CTCTGGGTTTACTGAGAAGAGGG + Intergenic
1063201558 10:3788831-3788853 TTTTGTGTTTTTAGTGGAGATGG + Intergenic
1063252321 10:4287080-4287102 TTTTGTGTTTTTAGTAAAGACGG + Intergenic
1063310424 10:4946690-4946712 TTCTGTGTCTACAGAAAACAGGG + Intronic
1063365534 10:5488194-5488216 TTTTGTATTTTTAGTGAAGATGG + Intergenic
1063401374 10:5749198-5749220 TTCTTTTGTTATAGAGAAGTTGG - Exonic
1063456911 10:6190112-6190134 TTTTGTGTTTTTAGTGGAGATGG + Intronic
1063461640 10:6218600-6218622 TTTTGTATTTTTAGAGGAGACGG + Intronic
1063488848 10:6444951-6444973 TTCTGTGTTTTTAGTAGAGACGG - Intronic
1063501690 10:6560865-6560887 TTTTGTATTTTTAGTGAAGATGG - Intronic
1063524227 10:6769510-6769532 TTTTGTATTTTTAGTGAAGACGG - Intergenic
1063574181 10:7246546-7246568 TTTTGTGTTTTTAGTGGAGATGG - Intronic
1063680666 10:8184567-8184589 TTTTGTGTTTTTAGTAAAGACGG - Intergenic
1063730210 10:8687800-8687822 TTTTGTGTTTATAGTAGAGATGG - Intergenic
1063734137 10:8733230-8733252 TTCTGTGTTTTTAGTACAGACGG - Intergenic
1063920773 10:10930624-10930646 TTCAGAGTTTATAGAGCAAAGGG + Intergenic
1064038077 10:11931976-11931998 TTTTGTGTTTTTAGTAAAGACGG - Intronic
1064196272 10:13246326-13246348 TTTTGTATTTTTAGTGAAGATGG - Intergenic
1064205767 10:13322314-13322336 TTTTGTATTTTTAGTGAAGATGG + Intronic
1064263559 10:13806026-13806048 TTCTGTATTTTTAGTGGAGACGG + Intronic
1064286822 10:13998842-13998864 TACTAGGTTGATAGAGAAGAAGG - Intronic
1064287665 10:14006065-14006087 TCCTGTGTTTATAGAAGAGGAGG - Intronic
1064386423 10:14896111-14896133 TTTTGTGTTTTTAGTAAAGATGG + Intronic
1064428282 10:15249264-15249286 TTTTGTATTTTTAGTGAAGATGG + Intronic
1064466442 10:15587091-15587113 TTTTGTGTTTTTAGTAAAGACGG + Intronic
1064488418 10:15822202-15822224 GCCTGTGTTTATAGGAAAGAGGG - Intronic
1064523450 10:16228324-16228346 TTTTGTGTTTTTAGTGGAGATGG - Intergenic
1064586667 10:16846069-16846091 TTTTGTGTTTATATATAAAATGG - Intronic
1064598537 10:16970402-16970424 TTTTGTGTTTTTAGTGGAGATGG - Intronic
1064712195 10:18139604-18139626 TTTTGTGTTTTTAGTGCAGACGG - Intergenic
1064806213 10:19137055-19137077 TGCTTTGATTAAAGAGAAGATGG + Intronic
1064826338 10:19406878-19406900 TTGTGTTTTTATGGAGAAGTTGG - Intronic
1064880281 10:20044478-20044500 TTTTGTATTTATAGCGGAGACGG + Intronic
1064984796 10:21199200-21199222 TTTTGTGTTTTTAGAGATGGGGG + Intergenic
1065272765 10:24052887-24052909 TTATGTGATTATAGAAGAGATGG - Intronic
1065404728 10:25351129-25351151 TTATATGTTTATAGAGAAGGGGG - Intronic
1065534649 10:26705642-26705664 TTTTGTATTTTTAGTGAAGACGG + Intronic
1065714979 10:28557687-28557709 TTGTGTCTTTAAAGAGAAAAAGG + Intronic
1066108194 10:32174020-32174042 TTTTGTGTTTTTAGTTAAGACGG - Intergenic
1066366659 10:34783430-34783452 TTTTGTATTTTTAGTGAAGACGG - Intronic
1066460176 10:35606215-35606237 TTCTGTGTTTTTAGTAGAGACGG + Intronic
1066637188 10:37515835-37515857 TTTTGTATTTTTAGTGAAGACGG - Intergenic
1066691718 10:38035286-38035308 TTTTGTGTTTTTAGAAGAGATGG + Intronic
1066692018 10:38038773-38038795 GATTGTTTTTATAGAGAAGATGG + Intronic
1066726011 10:38395093-38395115 ATCTGTCTTTATAAAGGAGATGG - Intergenic
1066976309 10:42371055-42371077 TTTTGTATTTTTAGTGAAGAAGG - Intergenic
1067000689 10:42609859-42609881 GATTGTTTTTATAGAGAAGATGG - Intronic
1067050826 10:43019260-43019282 TTTTTTTTTTGTAGAGAAGACGG - Intergenic
1067117635 10:43447410-43447432 TTCTGTATTTTTAGTAAAGACGG + Intronic
1067189369 10:44056775-44056797 TTCTTTGTTTGCAGAGTAGAGGG + Intergenic
1067204928 10:44204551-44204573 TTCTGTGTTGATAGAGAATTTGG - Intergenic
1067384953 10:45810512-45810534 TTCTGTATTTTTAGTGGAGACGG + Intergenic
1067674222 10:48356669-48356691 TTTTGTATTTTTAGTGAAGACGG - Intronic
1067843102 10:49697720-49697742 TTTTGTGTTTTTAGTAAAGACGG + Intronic
1068019395 10:51562051-51562073 TTTTGTGTTTTTAGTAAAGATGG - Intronic
1068550869 10:58406144-58406166 TTTTGTGTTTAAAGAGATAAAGG + Intergenic
1068964250 10:62895814-62895836 TTTTGTGTTTGTAGTAAAGATGG - Intronic
1069447617 10:68488021-68488043 TTTTGTGTTTTTAGTAAAGACGG + Intronic
1069521661 10:69126289-69126311 TTTTGTATTTTTAGTGAAGACGG - Intronic
1070063756 10:73012964-73012986 TTTTGTATTTATAGTGGAGAAGG + Intronic
1070295477 10:75157551-75157573 TTCTCTGTTTAAAGACAAAATGG + Intronic
1070615419 10:77966146-77966168 TTTTGTATTTTTAGTGAAGACGG - Intergenic
1070656166 10:78273070-78273092 TTCTGTTTGTACAGAGAAGGGGG - Intergenic
1070837264 10:79457227-79457249 TTCTGTGTTTTTAGTAGAGACGG + Intergenic
1071812473 10:89198536-89198558 TTCTGTATTTTTAGTAAAGATGG - Intergenic
1072044342 10:91639614-91639636 TTTTGTATTTTTAGAGGAGATGG + Intergenic
1072140513 10:92585219-92585241 TTTTGTGTTTTTAGTAAAGACGG - Intergenic
1072330357 10:94342912-94342934 TTCTGTATTTTTAGTAAAGATGG - Intronic
1072664324 10:97382930-97382952 TTTTGTATTTTTAGTGAAGATGG + Intronic
1072687592 10:97547733-97547755 TTTTGTGTTTTTAGTGGAGATGG + Intronic
1072696059 10:97603731-97603753 TTTTGTGCTTTTAGTGAAGACGG + Intronic
1073172187 10:101519823-101519845 TTCTGTATTTTTAGTAAAGACGG - Intronic
1073224763 10:101908831-101908853 TTCTGTGTTTTTAGTAGAGAAGG + Intronic
1073289541 10:102406677-102406699 TTTTGTGTTTTTAGTGGAGACGG + Intronic
1073973821 10:109076399-109076421 TTTTGTGTTTTTAGTGGAGATGG - Intergenic
1074052121 10:109889371-109889393 TTCTGTATTTTTAGTAAAGACGG + Intronic
1074173794 10:110975325-110975347 TTTTGTGTTTTTAGTAAAGACGG + Intronic
1074287676 10:112113710-112113732 TTTTGTATTTTTAGAAAAGATGG - Intergenic
1074288174 10:112118177-112118199 TTTTGTATTTTTAGTGAAGATGG - Intergenic
1074299180 10:112217946-112217968 TTCATTGTTTATGGAGAAAATGG + Intergenic
1074324798 10:112439458-112439480 TTTTGTGTTTTTAGTGGAGACGG - Intronic
1074495357 10:113975585-113975607 TTCTGTATTTTTAGTAAAGATGG + Intergenic
1074598211 10:114886929-114886951 TTCTCTGTTTTTACAGAAGAAGG + Intronic
1074646382 10:115457644-115457666 TTCTGATTTTATTGAGAAAATGG + Intronic
1074764542 10:116691114-116691136 ATCTGTTTTTATAGGGATGAAGG - Intronic
1075051347 10:119184560-119184582 TTTTGTGTTTTTAGCGGAGATGG + Intergenic
1075231396 10:120682158-120682180 TTCTGTGTTTTTAGTAGAGATGG - Intergenic
1075334921 10:121601751-121601773 TTTTGTGTTTTTAGTGGAGACGG - Intergenic
1075767400 10:124904515-124904537 TTCTGTGTTTTTAGTAGAGACGG - Intergenic
1075953893 10:126505782-126505804 TTCTGTATTTTTAGTGGAGACGG - Intronic
1076454264 10:130578562-130578584 TTTTGTGTTTTTAGTGGAGACGG + Intergenic
1076472663 10:130729632-130729654 TTTTGTGTTTTTAGAACAGACGG + Intergenic
1076661874 10:132060847-132060869 TTTTGTGTTTTTAGTGGAGACGG - Intergenic
1077097997 11:807603-807625 TTTTGTGTTTTTAGTGGAGACGG - Intronic
1077099253 11:814312-814334 TTTTGTATTTTTAGAAAAGATGG + Intergenic
1077572264 11:3349788-3349810 TTCTGTATTTTTAGTAAAGATGG + Intronic
1078029152 11:7731195-7731217 TTTTGTGTTTTTAGTCAAGATGG + Intergenic
1078114317 11:8430185-8430207 TTCTATGGTTATAGAAAAAAAGG + Intronic
1078278941 11:9879911-9879933 TTTTGTATTTTTAGTGAAGACGG - Intronic
1078981910 11:16545363-16545385 TTCTGTGTCTATTGAGATGTGGG - Intronic
1079194279 11:18311679-18311701 TTTTGTGTTTTTAGTGGAGACGG + Intronic
1079206107 11:18416264-18416286 TTCTATGTTTATAGTGAACCAGG + Intronic
1079223276 11:18583387-18583409 TTTTGTGTTTTTAGTGGAGATGG + Intronic
1079297646 11:19247544-19247566 TTTTGTGTTTTTAGTGGAGACGG - Intergenic
1079423598 11:20318103-20318125 TTCTGTGTTTTTAGTACAGATGG - Intergenic
1079554940 11:21748059-21748081 TTCTGTGTTAAAATAGCAGATGG - Intergenic
1080093995 11:28382661-28382683 TTTTGTATTTATAGAAGAGATGG - Intergenic
1080121884 11:28687199-28687221 TTCTGTATTTTTAGTGGAGATGG + Intergenic
1080338744 11:31231665-31231687 ATCTGTGTTTATGGAGGAGAAGG - Intronic
1080430976 11:32199515-32199537 TTCTGTACTTACAGAGTAGAGGG + Intergenic
1080832719 11:35911005-35911027 TTTTGTATTTTTAGAAAAGACGG + Intergenic
1081321432 11:41696331-41696353 TTTTGTGTTTTTAGAGGAGTCGG - Intergenic
1081398408 11:42614247-42614269 TTCTGTATTTTTAGAAGAGATGG + Intergenic
1081557026 11:44173738-44173760 TTTTGTGTTTTTAGTGGAGACGG + Intronic
1081640252 11:44748235-44748257 TTCTGTATTTTTAGTAAAGATGG - Intronic
1081845996 11:46240876-46240898 TTTTGTATTTCTAGAAAAGATGG + Intergenic
1081890124 11:46534320-46534342 TTCTGTATTTTTAGTAAAGACGG - Intronic
1082022885 11:47549985-47550007 TTCTGTATTTTTAGTGGAGATGG + Intronic
1082031359 11:47606603-47606625 TTCTAAGTTTAGAGACAAGATGG - Intergenic
1082247195 11:49937675-49937697 TTGTGTGTGTATCCAGAAGAGGG - Intergenic
1082762025 11:57136589-57136611 TTTTGTGTTTCTAGTGGAGATGG - Intergenic
1082873509 11:57965507-57965529 TTTTGTGTTTTTAGTGGAGACGG + Intergenic
1082991733 11:59212512-59212534 TTCTGTGTTGATGGAGTAGGAGG + Exonic
1083032388 11:59604979-59605001 TTTTGTGTTTTTAGTGGAGATGG - Intronic
1083157057 11:60829935-60829957 TTTTGTGTTTTTAGTAAAGATGG - Intergenic
1083370350 11:62174008-62174030 TTTTGTGTTTATAGTAGAGACGG + Intergenic
1083455597 11:62776678-62776700 TTCTGTATTTTTAGTAAAGAAGG - Intronic
1083456173 11:62780146-62780168 TTTTGTATTTTTAGTGAAGATGG - Intronic
1083490422 11:63011430-63011452 TTCTGTGTTTTTGGAGGACATGG + Intronic
1083666780 11:64279593-64279615 TTTTGTGTTTTTAGTGGAGACGG - Intronic
1083883967 11:65561905-65561927 TTTTGTATTTTTAGTGAAGATGG + Intergenic
1084829656 11:71759250-71759272 TTTTGTGTTTTTAGTAAAGACGG + Intergenic
1085091559 11:73719784-73719806 TTTTGTATTTTTAGAAAAGATGG + Intronic
1085460132 11:76688664-76688686 TTTTGTGTTTTTAGTAAAGATGG + Intergenic
1085940942 11:81206159-81206181 TTTTGTATTTTTAGTGAAGATGG - Intergenic
1086333601 11:85777987-85778009 TTTTGTATTTTTAGTGAAGATGG + Intronic
1086466033 11:87054262-87054284 TTTTGTATTTTTAGTGAAGATGG - Intronic
1086885044 11:92196058-92196080 TTTTGTGTTTATAGTAGAGATGG - Intergenic
1087408916 11:97765971-97765993 TTCTGTATTTTTAGTAAAGACGG + Intergenic
1087426462 11:97993203-97993225 TTTTGTGTTTTTAGTGGAGATGG - Intergenic
1087778766 11:102281658-102281680 TTCTGTATTTTTAGTGGAGACGG - Intergenic
1088028731 11:105219772-105219794 GTCTGTATTTATAGTGGAGACGG - Intergenic
1088201147 11:107336315-107336337 TTTTGTATTTTTAGTGAAGATGG + Intronic
1088277557 11:108103391-108103413 GTCTGTATTTAAAGAGAAGAAGG + Intronic
1089010143 11:115125547-115125569 TTCTGTGTCTATTGACTAGAAGG - Intergenic
1089249458 11:117147096-117147118 TTTTGTATTTTTAGTGAAGACGG - Intronic
1089421416 11:118333859-118333881 TTCTGTTTCTCTAGAGAAGTTGG - Intergenic
1089482315 11:118816071-118816093 TTTTGTATTTTTAGAGGAGATGG - Intergenic
1089850519 11:121492188-121492210 TTTTGTGTTTTTAGTGGAGATGG - Intronic
1090067621 11:123517088-123517110 TTTTGTGTTTTTAGTGGAGACGG + Intergenic
1090560993 11:127932370-127932392 TTTTGTGTTTTTAGTAAAGACGG - Intergenic
1090925606 11:131247433-131247455 TTCTATTTTTCTAGAGTAGAAGG - Intergenic
1091241939 11:134058854-134058876 TTCTGTATTTTTAGTGGAGACGG + Intergenic
1091358435 11:134956094-134956116 CTATCTGTTTAGAGAGAAGAGGG + Intergenic
1091564442 12:1638074-1638096 TTTTGTGTTTTTAGTGGAGATGG - Intronic
1091762903 12:3098921-3098943 TTTTGTGTTTTTAGTAAAGATGG + Intronic
1091942269 12:4498649-4498671 TTTTGTGTTTATATAGCAGCAGG + Intronic
1091948256 12:4568554-4568576 TTTTGTATTTTTAGAGGAGATGG + Intronic
1092232099 12:6781796-6781818 TTCTGTGTTTTTAGTAGAGACGG + Intergenic
1092259235 12:6943789-6943811 GTATGTGTTTGGAGAGAAGATGG - Intronic
1092440621 12:8498388-8498410 TTTTGTGTTTTTAGTGCAGACGG + Intergenic
1092558990 12:9589656-9589678 TTCTGTGTTTCTAGTGGAGATGG - Intergenic
1092757207 12:11774874-11774896 TTCTGAGTTTATGCAGCAGAGGG + Intronic
1092758162 12:11784257-11784279 TTTTGTATTTTTAGTGAAGACGG - Intronic
1092799993 12:12155023-12155045 TTTTGTGTTTTTAGTGGAGACGG - Intronic
1092823566 12:12375973-12375995 TTCTGTATTTTTAGTGGAGATGG + Intronic
1092875831 12:12846896-12846918 TTTTGTATTTATAGTGGAGACGG - Intergenic
1092888050 12:12942562-12942584 TTTTGTATTTTTAGTGAAGACGG - Intronic
1093037367 12:14345403-14345425 TTCTGTGTTTTTAGTAGAGACGG + Intergenic
1093232197 12:16559778-16559800 TTCATTTTTTATAGAGATGATGG - Intronic
1093553146 12:20438963-20438985 TTTTGTGTTTTTAGTGAAGACGG + Intronic
1093564825 12:20589694-20589716 TTTTGTGTTTTTAGTGGAGATGG - Intronic
1094465304 12:30747505-30747527 TTTTGTGTTTTTAGTGGAGATGG - Intronic
1094679385 12:32654202-32654224 TTTTGTATTTTTAGAGGAGATGG - Intergenic
1094694421 12:32803440-32803462 ATCTGTGTTTATAAATAAAATGG + Intronic
1094695892 12:32818288-32818310 TTCTGTATTTATAGTAGAGACGG - Intronic
1094708085 12:32934212-32934234 TTTTGTATTTTTAGAGGAGATGG + Intergenic
1094794362 12:33953582-33953604 TTCTATTTATATACAGAAGATGG - Intergenic
1095106216 12:38236197-38236219 TTCTATTTATATACAGAAGATGG - Intergenic
1095181253 12:39148966-39148988 TTTTGTATTTTTAGTGAAGATGG + Intergenic
1095560539 12:43560032-43560054 TTTTGTTTTTTTAAAGAAGAGGG + Intergenic
1096249316 12:50017985-50018007 TTTTGTGTTTTTAGAAGAGACGG - Intronic
1096280497 12:50248748-50248770 TTCAGTGTCTGTAGACAAGATGG - Exonic
1096288186 12:50318371-50318393 TTTTGTGTTTTTAGTGGAGATGG + Intergenic
1096290159 12:50335471-50335493 TTTTGTGTTTTTAGAGGAGATGG - Intronic
1096333541 12:50735633-50735655 TTTTGTGTTTTTAGTAAAGATGG + Intronic
1096480301 12:51935861-51935883 CTCTGTGTGCATAGGGAAGAAGG - Intergenic
1096505647 12:52090884-52090906 TTCAGTGTGTATTGAGAGGATGG - Intergenic
1096624007 12:52882161-52882183 TTCTGTGTTTTTAGTAGAGACGG - Intergenic
1096681771 12:53260400-53260422 TTTTTTTTTTGTAGAGAAGATGG + Intergenic
1097043170 12:56168542-56168564 TTCTGTGTTTTTAGTAGAGATGG + Intronic
1097652767 12:62322296-62322318 TTTTGTGTTTATAGTAGAGATGG + Intronic
1097740249 12:63233562-63233584 TTTTGTGTTTTTAGTGGAGACGG + Intergenic
1097952350 12:65445814-65445836 TTCTGTATTTTTAGTAAAGATGG + Intronic
1098137421 12:67417294-67417316 TTTTGTGTTTTTAGTGGAGACGG - Intergenic
1098346006 12:69504031-69504053 TTCTGTGTTTTTAGTAGAGACGG - Intronic
1098941397 12:76541305-76541327 TTTTGTGTTTTTAGTGGAGATGG - Intronic
1099575084 12:84368832-84368854 TTCTGTGTTTAAAAACTAGATGG + Intergenic
1099676165 12:85763048-85763070 TTTTGTGTTTTTAGTGGAGACGG + Intergenic
1099739405 12:86612577-86612599 TTGTGTGTTTTTAGTAAAGACGG - Intronic
1099785958 12:87264305-87264327 TTCTTTGTTTTTAAAGAAGGAGG - Intergenic
1099812625 12:87604432-87604454 TTTTGTATCTTTAGAGAAGAGGG - Intergenic
1100001400 12:89840635-89840657 TTTTGAGTTCAAAGAGAAGATGG + Intergenic
1100126540 12:91433672-91433694 TTCTGTGTTTTTAGTAGAGATGG - Intergenic
1100181045 12:92087097-92087119 TTTTGTGTTTTTAGTAAAGACGG + Intronic
1100508698 12:95246291-95246313 TTCTGTGTTTTTAGTAGAGACGG + Intronic
1100851156 12:98712988-98713010 TTCTGTTTTTGTAGAGATGGAGG + Intronic
1100882807 12:99037342-99037364 TTCTGTATTTTTAGTCAAGATGG - Intronic
1100945005 12:99772551-99772573 GTCTGAGTTCATAGAGAAAATGG + Intronic
1101185305 12:102270192-102270214 TTTTGTATTTTTAGAGGAGATGG + Intergenic
1101379969 12:104205955-104205977 TTCTCATTTTATAAAGAAGATGG + Intergenic
1101764888 12:107688601-107688623 TTCTGTGCTCATAGAGAAGAAGG + Exonic
1101895073 12:108750306-108750328 TTTTGTATTTCTAGCGAAGATGG + Intergenic
1102070570 12:110015715-110015737 TTTTGTATTTATAGTGGAGATGG + Intronic
1102104860 12:110312677-110312699 TTTTGTATTTTTAGTGAAGATGG - Intronic
1102127021 12:110491861-110491883 TTATGTATTAACAGAGAAGATGG + Exonic
1102209534 12:111115455-111115477 TTCTGTGTTTTTAGTAGAGATGG + Intronic
1102239410 12:111314671-111314693 TTTTGTATTTTTAGAGGAGATGG - Intronic
1102289748 12:111689545-111689567 TTCTGTGTTTTTAGTAGAGACGG + Intronic
1102302136 12:111778659-111778681 TTCTGTGTTTTTAGTAGAGACGG - Intronic
1102597497 12:114004145-114004167 TTTTGTGTTTTTAGTAAAGACGG + Intergenic
1102873626 12:116432986-116433008 TTTTGTGTTTTTAGTGGAGATGG + Intergenic
1102909751 12:116703867-116703889 TTTTGTGTTTTTAGTAAAGATGG - Intergenic
1103100664 12:118171806-118171828 TTCTGTGTATATAGAGTGGCGGG - Intronic
1103112400 12:118291983-118292005 TTTTGTATTTTTAGTGAAGACGG + Intronic
1103519483 12:121528386-121528408 TTTTGTGTTTTTAGTGGAGACGG - Intronic
1103603818 12:122071961-122071983 TTCTGTATTTTTAGTGGAGACGG - Intergenic
1103732377 12:123036509-123036531 TTCTTTTTTAATAGAGAGGAGGG - Intronic
1103787311 12:123442449-123442471 TTTTGTGTTTTTAGCGGAGACGG - Intergenic
1104045113 12:125156847-125156869 TTTTGTGTTTTTAGTCAAGACGG + Intergenic
1104453782 12:128893072-128893094 TTTTGTATTTTTAGTGAAGACGG - Intronic
1104453838 12:128893754-128893776 TTTTGTATTTTTAGTGAAGATGG + Intronic
1105010433 12:132752539-132752561 TTCTGTATTTTTAGTAAAGACGG + Intronic
1105058788 12:133129329-133129351 TTCTGTATTTTTAGTGGAGATGG - Intronic
1105455735 13:20539675-20539697 TTTTGTGTTTTTAGTAAAGATGG - Intergenic
1105823269 13:24098754-24098776 TTTTGTGTTTTTAGTAAAGACGG - Intronic
1106038890 13:26070798-26070820 TTTTGTGTTTTTAGTGGAGACGG + Intergenic
1106709860 13:32318611-32318633 TTTTGTGTTTTTAGTAAAGATGG + Intronic
1106713708 13:32366394-32366416 TTATATGATTATAGAGAACAGGG + Intronic
1107015869 13:35707248-35707270 TTTTGTGTTTTTAGTAAAGATGG + Intergenic
1107037590 13:35917492-35917514 TTCTGTGTTTAGAGGTAGGACGG - Intronic
1107464012 13:40632465-40632487 TTTTGTGTTTTTAGTGGAGATGG - Intronic
1107633305 13:42364785-42364807 TTCTGTGCTTGTAGAGGAGTTGG + Intergenic
1107946469 13:45421206-45421228 TTTTGTGTTTTTAGTGGAGATGG - Intergenic
1108122195 13:47201360-47201382 TTTTGTATTTTTAGTGAAGATGG + Intergenic
1108336407 13:49445756-49445778 TTTTGTGTTTTTAGTGGAGACGG - Intronic
1109581645 13:64347040-64347062 TTCTGTGTTTGTAGTAGAGACGG - Intergenic
1109830779 13:67784574-67784596 TTCTGTATTTTTAGTGGAGATGG - Intergenic
1109991945 13:70069994-70070016 TTTTGTGTTTTTAGTGGAGACGG - Intronic
1110107791 13:71700383-71700405 TTTTGTGTTTTTAGTGGAGACGG - Intronic
1110111656 13:71754922-71754944 TTCTGTTTTTATCCAGGAGATGG + Intronic
1110141765 13:72139140-72139162 TATTTTGTCTATAGAGAAGATGG + Intergenic
1110214027 13:73006087-73006109 TTTTGTGTTTTTAGTAAAGACGG + Intronic
1110273270 13:73615273-73615295 CACTGTTTTTAAAGAGAAGAAGG - Intergenic
1110432493 13:75441082-75441104 TTTTGTGTTTTTAGTAAAGACGG - Intronic
1110944705 13:81397616-81397638 TTCTGTATTTTTAGTAAAGATGG - Intergenic
1111187840 13:84763710-84763732 TTCTTTATTTATAGAAAAAAAGG + Intergenic
1111212748 13:85101039-85101061 TTTTGTGTTTTTAGTAAAGACGG - Intergenic
1111566021 13:90017219-90017241 TTTTGTGTTTTTAGTGGAGACGG + Intergenic
1111693974 13:91600091-91600113 TTTTGTATTTTTAGAGGAGACGG + Intronic
1111947423 13:94680434-94680456 TTTTGTATTTCTAGTGAAGACGG - Intergenic
1112331084 13:98477500-98477522 TTCTGTGTTTTTAGTAGAGATGG - Intronic
1112481528 13:99780552-99780574 TTGTGTGTTTATAGCAGAGATGG + Intronic
1112511244 13:100011295-100011317 TTTTGTATTTATAGAATAGACGG + Intergenic
1112514120 13:100037246-100037268 TTGTGTGTTTTTAGTGGAGACGG + Intergenic
1112763199 13:102713404-102713426 TTTTGTGTTTTTAGTGAAGACGG + Intergenic
1112776970 13:102854912-102854934 TTCTGTGTTTGAAGTGAAGGTGG + Intronic
1113368097 13:109696763-109696785 TTCTGTGTTGGGATAGAAGATGG - Intergenic
1113389251 13:109880014-109880036 TTTTGTGTTTTTAGTAAAGATGG - Intergenic
1113402552 13:110007164-110007186 TTTTGTATTTTTAGAGGAGACGG + Intergenic
1113455064 13:110442594-110442616 TTCTGTGTTTATGTAGAGGAGGG - Intronic
1113462284 13:110490709-110490731 TTCTGTGTTTATAAACCAAATGG - Intronic
1113562036 13:111289202-111289224 TTTTGTGTTTTTAGTAAAGATGG + Intronic
1113607304 13:111618831-111618853 TTCTGTGTCTCTAGACAAAAAGG - Intronic
1113731475 13:112644653-112644675 TTTTGTGTTTTTAGTAAAGATGG - Intergenic
1113764458 13:112872438-112872460 TTTTGTGTTTTTAGTAAAGATGG - Intronic
1114421196 14:22584538-22584560 TACTGTTTTTAAAGAGAACAAGG - Intronic
1114448333 14:22807069-22807091 TTCTGTATTTTTAGTAAAGACGG + Intronic
1114506692 14:23220651-23220673 TTCTGTATTTTTAGTAAAGATGG - Intronic
1114652447 14:24294280-24294302 TTCTGTGTATATAAAGAGCAGGG + Intronic
1115206779 14:30915971-30915993 ATGTGTGTATATAGAGAAAAAGG - Intronic
1115535986 14:34373846-34373868 TTTTGTATTTTTAGAGGAGATGG - Intronic
1115588657 14:34841116-34841138 TTTTGTGTTTTTAGTAAAGATGG + Intronic
1115750387 14:36483454-36483476 TTCAGTGATAATAGAGAGGATGG - Intronic
1116017260 14:39422085-39422107 TTTTGTGTTTTTAGTAAAGACGG - Intronic
1116023247 14:39486394-39486416 TTTTGTGTTTTTAGTGGAGATGG + Intergenic
1116056666 14:39872667-39872689 TTTTGTGTTTATAGTAGAGACGG + Intergenic
1116138244 14:40955101-40955123 TTGTGAGTTTACAGAGAAAAGGG - Intergenic
1116149806 14:41126602-41126624 TTCTGTATTTTTAGTAAAGAAGG + Intergenic
1116178944 14:41511362-41511384 TTTTGTATTTTTAGAAAAGACGG - Intergenic
1116179040 14:41512518-41512540 TTTTGTATTTTTAGAAAAGACGG - Intergenic
1116791232 14:49342509-49342531 TTTTGTGTTTTTAGTAAAGACGG - Intergenic
1116816716 14:49590859-49590881 TTTTGTGTTTTTAGTAAAGACGG + Intronic
1116909354 14:50442813-50442835 TTCTTTCTTTATAAATAAGATGG - Exonic
1116952375 14:50891413-50891435 TTCTGTGTTTTTAGTAGAGACGG + Intronic
1117019706 14:51557302-51557324 TTCAGCCTTTAAAGAGAAGAAGG + Intronic
1117135591 14:52731606-52731628 TTTTGTGTTTTTAGGGGAGACGG + Intronic
1117393796 14:55288878-55288900 TTTTGTGTTTTTAGTAAAGATGG - Intronic
1117702191 14:58425238-58425260 TTTTGTGTTTTTAGTAAAGATGG - Intronic
1117731781 14:58729852-58729874 TTTTGTATTTTTAGTGAAGACGG - Intergenic
1117771492 14:59138344-59138366 TTTTGTGTTTTTAGTAAAGACGG - Intergenic
1117887415 14:60379980-60380002 TTTTGTGTTTTTAGTGGAGATGG - Intergenic
1117903596 14:60561581-60561603 TTCTCTGTTTAGGGAGAAGGTGG + Intergenic
1117916761 14:60685825-60685847 TTTTGTGTTTTTAGTGGAGATGG - Intergenic
1118016904 14:61670020-61670042 TTCTGTGTTTTTAGTAGAGATGG - Intergenic
1118191600 14:63585670-63585692 TTTTGTGTTTTTAGTAAAGACGG + Intergenic
1118264910 14:64285655-64285677 TTTTGTATTTTTAGTGAAGATGG - Intronic
1118358027 14:65031486-65031508 TTTTGTGTTTTTAGTGGAGACGG + Intronic
1118898293 14:69965205-69965227 TTGTGTGTTTTTAGTGGAGATGG - Intronic
1119275679 14:73353255-73353277 TTTTGTGTTTTTAGTAAAGAAGG + Intronic
1119291644 14:73500055-73500077 TTTTGTGTTTTTAGTAAAGATGG - Intronic
1119310487 14:73642361-73642383 TTTTGTGTTTTTAGTGGAGACGG + Intergenic
1119358492 14:74027255-74027277 TTTTGTGTTTGTAGTAAAGACGG + Intronic
1119597925 14:75953789-75953811 CACTGTGTTTCTAGAAAAGATGG + Intronic
1119752082 14:77086386-77086408 TTTTGGGTTTCTAGAAAAGAAGG - Intergenic
1120416059 14:84219746-84219768 TTTTGTATTTTTAGTGAAGATGG + Intergenic
1120425715 14:84345255-84345277 TTTTGTGTTTTTAGTAAAGATGG + Intergenic
1120434750 14:84466951-84466973 AATTGTGATTATAGAGAAGATGG + Intergenic
1120472908 14:84949400-84949422 TTCTGTATTTTTAGTAAAGATGG + Intergenic
1120540776 14:85747828-85747850 TTTTGTGTTTTTAGTGGAGACGG + Intergenic
1120542196 14:85764202-85764224 TTTTGTGTTTTTAGTGGAGATGG - Intergenic
1120789487 14:88566048-88566070 TTTTGTGTTTTTAGTGGAGACGG + Intronic
1120924953 14:89788447-89788469 TTCTGTATTTTTAGCGGAGATGG - Intergenic
1120994076 14:90402052-90402074 TACTGTGTTTAAAGAGGAGGAGG + Intronic
1121149127 14:91614628-91614650 TTTTGTGTTTTTAGTAAAGATGG - Intronic
1121506754 14:94483554-94483576 TTCTGTATTTTTAGTAAAGACGG + Intergenic
1121558416 14:94856030-94856052 TTTTGTGTTTTTAGTGGAGATGG + Intergenic
1121650585 14:95554956-95554978 TTTTGTATTTTTAGTGAAGATGG - Intergenic
1121712416 14:96048694-96048716 TTTTGTGTTTTTAGTGGAGATGG + Intronic
1121907601 14:97761321-97761343 TTTTGTGTTTTTAGTAAAGACGG - Intronic
1121992351 14:98571697-98571719 TGCTGTGGTTATAGAAAGGACGG + Intergenic
1122030074 14:98905701-98905723 TTTTGTGTTTTTAGTAAAGACGG + Intergenic
1122032178 14:98920186-98920208 TTTTGTGTTTTTAGTAAAGATGG - Intergenic
1122095362 14:99366566-99366588 TTTTGTGTTTTTAGTGGAGACGG + Intergenic
1122157664 14:99759934-99759956 TTCTGTATTTATAGTAGAGACGG - Intronic
1122225029 14:100270764-100270786 TTCTGTGTTGAGTGTGAAGATGG - Intronic
1122241553 14:100371562-100371584 TTTTGTATTTTTAGTGAAGATGG - Intronic
1122303413 14:100745528-100745550 TTTTGTGTTTTTAGTAAAGACGG + Intergenic
1122422275 14:101585054-101585076 TTTTGTGTTTTTAGTAAAGACGG + Intergenic
1123173009 14:106391585-106391607 TTTTGTGTTTTTAGTGGAGACGG + Intergenic
1123771267 15:23531772-23531794 TTTTGTGTTTTTAGTGGAGACGG + Intergenic
1124497802 15:30196929-30196951 TTCTGTGTCTTTAGTAAAGACGG + Intergenic
1124593283 15:31071791-31071813 TTTTGTGTTTATGGTGGAGACGG - Intronic
1124745783 15:32341756-32341778 TTCTGTGTCTTTAGTAAAGACGG - Intergenic
1124951203 15:34322805-34322827 TTTTGTGTTTTTAGTGGAGACGG - Intronic
1125431482 15:39599093-39599115 TTCTGTATTTTTAGTAAAGACGG + Exonic
1125625540 15:41106083-41106105 TTCTATTTTTATAGAGAGGTGGG - Intronic
1125766805 15:42141774-42141796 TTGTGTGTTTTTGGAGAAGATGG - Exonic
1125825457 15:42672636-42672658 TTGTGTGTTTGCAGAGAGGAGGG + Intronic
1125845423 15:42848021-42848043 TTCTTAGTTTATAGAGATGCGGG + Intronic
1126482720 15:49143812-49143834 TTTTGTGTTTTTAGAAGAGACGG - Intronic
1127364647 15:58276568-58276590 TTTTGTGTTTTTAGTAAAGACGG + Intronic
1127938904 15:63672936-63672958 ATTTCTGTTTTTAGAGAAGAGGG + Intronic
1128010102 15:64285774-64285796 TTCTGTGCTTTTAGAAAACATGG - Intronic
1128235442 15:66064195-66064217 TTCTGTGTTTTTAGTAGAGATGG - Intronic
1128287255 15:66447518-66447540 TTTTGTGTTTTTAGTGGAGACGG - Intronic
1128404671 15:67323412-67323434 TTTTGTATTTTTAGTGAAGACGG + Intronic
1129021382 15:72522341-72522363 TTTTGTGTTTTTAGTAAAGATGG - Intronic
1129141209 15:73599441-73599463 TTTTGTGTTTATAGTAGAGACGG - Intronic
1129437139 15:75550615-75550637 TTTTGTGTTTTTAGTAAAGATGG - Intronic
1129487142 15:75885286-75885308 TTTTGTGTTTTTAGTGGAGATGG + Intronic
1129995768 15:80003826-80003848 TTTTGTGTTTTTAGTAAAGACGG - Intergenic
1130111578 15:80969682-80969704 TTTTGTGTTTTTAGTGGAGACGG - Intronic
1130517399 15:84636583-84636605 TTTTGTATTTTTAGAGGAGACGG - Intergenic
1130525422 15:84701894-84701916 TTGTGTATTTTTAGTGAAGATGG - Intronic
1130633739 15:85596670-85596692 TTCAGTGTTTGTACTGAAGATGG + Intronic
1130690150 15:86075336-86075358 TTCTGTGTTTAGAGTGGAGCGGG + Intergenic
1130801847 15:87272833-87272855 TTATTTGTTTATAGAGGAAAAGG + Intergenic
1131109368 15:89755336-89755358 TTTTGTGTTTTTAGTAAAGACGG + Intergenic
1131209403 15:90480836-90480858 TTTTGTATTTATAGTAAAGATGG + Intronic
1131232060 15:90666596-90666618 TTTTGTGTTTTTAGTTAAGACGG - Intergenic
1131756958 15:95575139-95575161 TTCTGTATTTTTAGAAGAGACGG + Intergenic
1132103029 15:99040802-99040824 TTTTGTATTTTTAGTGAAGATGG - Intergenic
1132258125 15:100396000-100396022 TTTTGTGTTTTTAGTAAAGACGG + Intergenic
1132323528 15:100945661-100945683 TTTTGTATTTTTAGAAAAGAAGG + Intronic
1132434726 15:101790016-101790038 TTTTGTGTTTTTAGTAAAGACGG + Intergenic
1132571227 16:645129-645151 TTTTGTGTTTATAGTAGAGACGG + Intronic
1133253255 16:4498822-4498844 TTCTGAGTTTATAGAATAAATGG - Intronic
1133300041 16:4776812-4776834 TTTTGTGTTTTTAGTGGAGACGG - Intergenic
1133311894 16:4853730-4853752 TTCTGTGTTTTTAGTAGAGATGG + Intronic
1133329623 16:4964414-4964436 TTTTGTATTTTTAGGGAAGACGG - Intronic
1133453633 16:5923709-5923731 TTTTGTGTTTTTAGTGGAGATGG + Intergenic
1133553508 16:6882422-6882444 TTTTGTATTTTTAGTGAAGATGG - Intronic
1133614236 16:7461336-7461358 TTTTGTATTTTTAGTGAAGATGG + Intronic
1133672908 16:8041470-8041492 TTCTGTGTTTTTAGTAGAGACGG - Intergenic
1133809485 16:9150054-9150076 TTTTGTGTTTTTAGTGGAGATGG + Intergenic
1133941322 16:10311541-10311563 TTTTGTATTTTTAGTGAAGATGG - Intergenic
1133942834 16:10324702-10324724 TTCTGTATTTTTAGTGGAGATGG - Intergenic
1133958187 16:10465565-10465587 TTCTGTGTTTTTAGTAGAGATGG - Intronic
1134061780 16:11203625-11203647 TTTTGTGTTTAAAGAGATGGGGG - Intergenic
1134225086 16:12383605-12383627 TTTTGTGTTTTTAGTAAAGACGG + Intronic
1134398243 16:13885128-13885150 TTCTGTGTTTTTAGTAGAGACGG + Intergenic
1134454370 16:14383582-14383604 TTTTGTGTTTTTAGTAAAGACGG - Intergenic
1135015452 16:18920965-18920987 TTTTGTGTTTTTAGTGGAGATGG - Intronic
1135029869 16:19029883-19029905 TTTTGTATTTTTAGTGAAGACGG + Intronic
1135048234 16:19171493-19171515 TTTTGTATTTTTAGAAAAGAGGG + Intronic
1135271762 16:21075740-21075762 TTTTGTGTTTTTAGTGGAGATGG - Intronic
1135321073 16:21496785-21496807 TTTTGTGTTTTTAGTGGAGATGG - Intergenic
1135373907 16:21928287-21928309 TTTTGTGTTTTTAGTGGAGATGG - Intergenic
1135437879 16:22442434-22442456 TTTTGTGTTTTTAGTGGAGATGG + Intergenic
1135450335 16:22551884-22551906 TTCTGTATTTTTAGTGGAGATGG + Intergenic
1135749999 16:25050315-25050337 TTTTGTGTTTTTAGAAGAGACGG + Intergenic
1136068771 16:27775824-27775846 TCCTGTGTTTTCAGAGAAAAAGG - Intronic
1136113443 16:28079461-28079483 TTCTTGGTTGATAGAGAAGTGGG - Intergenic
1136235663 16:28912072-28912094 TTTTGTGTTTATAGTAGAGACGG - Intronic
1136385609 16:29924002-29924024 TTTTGTGTTTTTAGTAAAGACGG - Intronic
1136483914 16:30558935-30558957 TTGTGTGTTTTTAGTGGAGACGG - Intergenic
1136503196 16:30684943-30684965 TTTTGTATTTTTAGTGAAGACGG - Intergenic
1136505796 16:30702402-30702424 TTCTGTGTTTTTAGTAGAGATGG + Intronic
1136566130 16:31071624-31071646 TTCTTTGTATATAGAGATGGAGG + Intronic
1136711298 16:32239415-32239437 TTTTGTGTTTTTAGTGGAGACGG - Intergenic
1136756609 16:32689992-32690014 TTTTGTGTTTTTAGTGGAGACGG + Intergenic
1136811501 16:33180383-33180405 TTTTGTGTTTTTAGTGGAGACGG - Intergenic
1136817977 16:33290463-33290485 TTTTGTGTTTTTAGTGGAGACGG - Intronic
1136824541 16:33346992-33347014 TTTTGTGTTTTTAGTGGAGACGG - Intergenic
1136829607 16:33445763-33445785 TTTTGTGTTTTTAGTGGAGACGG - Intergenic
1137284476 16:47003671-47003693 TTTTGTGTTTTTAGTAAAGACGG - Intergenic
1137301341 16:47150780-47150802 TTTTGTGTTTTTAGTAAAGATGG - Intergenic
1137489697 16:48921575-48921597 TTTTGTGTTTTTAGTGGAGACGG - Intergenic
1137638849 16:50010722-50010744 TTTTGTGTTTTTAGTGAAGATGG - Intergenic
1138126291 16:54441425-54441447 TTTTGTGTTTTTAGTAAAGACGG + Intergenic
1138313633 16:56049660-56049682 TTTTGTATTTTTAGTGAAGATGG - Intergenic
1138511623 16:57512028-57512050 TTTTGTGTTTTTAGTAAAGACGG + Intergenic
1138566518 16:57837295-57837317 TTCTGTGTTTTTAGTAGAGACGG - Intronic
1138587456 16:57979895-57979917 TTTTGTATTTTTAGTGAAGATGG - Intronic
1139207912 16:65046935-65046957 TTCTGTATTTTTAGTAAAGATGG - Intronic
1139500459 16:67359950-67359972 TTTTGTATTTTTAGTGAAGATGG - Intronic
1139538735 16:67597507-67597529 TTCTGTATTTTTAGTGGAGACGG + Intronic
1139689728 16:68632897-68632919 TTTTGTGTTTTTAGTGGAGATGG + Intergenic
1139839052 16:69863466-69863488 TTTTGTGTTTTTAGTAAAGACGG - Intronic
1139890375 16:70249777-70249799 TTTTGTATTTTTAGAGAAGATGG - Exonic
1140092052 16:71846420-71846442 TTCTGCGTTTAGAGAGTAGGGGG - Intronic
1140468238 16:75199233-75199255 TTTTTTTTTTGTAGAGAAGAGGG + Intergenic
1140640071 16:76961116-76961138 TTCTGTGTTTTTAGTAGAGACGG - Intergenic
1140641311 16:76976679-76976701 TTCTGTATTTTTAGTAAAGATGG - Intergenic
1141013370 16:80424330-80424352 TTTTGTATTTTTAGTGAAGATGG + Intergenic
1141111076 16:81271283-81271305 TTTTGTATTTTTAGAAAAGACGG + Intronic
1141180190 16:81747362-81747384 TTCTGTATTTTTAGTAAAGATGG - Intronic
1141250453 16:82352036-82352058 TTCTGTATTTTTAGTGGAGATGG + Intergenic
1141352328 16:83309545-83309567 TTTTGTATTTTTAGTGAAGATGG + Intronic
1141440445 16:84026395-84026417 TTTTGTATTTTTAGTGAAGATGG + Intronic
1141487553 16:84350938-84350960 TTCTGTATTTTTAGTAAAGATGG - Intergenic
1141688936 16:85585719-85585741 TTCCTTGTTTATAGAGCTGACGG + Intergenic
1141895811 16:86958005-86958027 GTCTGTGTTTACAGTGGAGATGG - Intergenic
1142298795 16:89244248-89244270 TTCTGTGTTTTTAGTAGAGATGG - Intergenic
1202990079 16_KI270728v1_random:3352-3374 TTTTGTGTTTTTAGTGGAGACGG - Intergenic
1203058758 16_KI270728v1_random:950344-950366 TTTTGTGTTTTTAGTGGAGACGG + Intergenic
1142528869 17:565229-565251 TTTTGTGTTTTTAGTGAAGACGG - Intronic
1143047992 17:4098066-4098088 TTTTGTGTTTTTAGTAAAGATGG - Intronic
1143220565 17:5257907-5257929 TTCTGTATTTTTAGTGGAGACGG - Intergenic
1143262160 17:5607489-5607511 TTTTGTATTTTTAGTGAAGATGG + Intronic
1143454206 17:7055474-7055496 TTTTGTGTTTTTAGTGGAGATGG - Intergenic
1143642275 17:8205919-8205941 TTTTGTGTTTTTAGTAAAGATGG + Intronic
1143909535 17:10236294-10236316 TTTTGTGTTTTTAGTGAAGACGG - Intergenic
1143947746 17:10608991-10609013 TTTTGTATTTTTAGTGAAGATGG - Intergenic
1144545191 17:16188437-16188459 TTTTGTGTTTTTAGTGGAGATGG - Intronic
1144997043 17:19277228-19277250 TTCTGTGTTTTTAGTAGAGATGG - Intronic
1145016127 17:19399491-19399513 TTTTGTGTTTTTAGTGGAGACGG - Intergenic
1145953168 17:28836158-28836180 TTGTGTGTTTTTAGAAGAGATGG + Intronic
1146014797 17:29224217-29224239 TTCTGTATTTTTAGAAGAGACGG + Intergenic
1146035209 17:29400221-29400243 TTTTGTGTTTTTAGTAAAGACGG - Intronic
1146222067 17:31032806-31032828 TTCTGTGTGAAAACAGAAGAGGG - Intergenic
1146227760 17:31081805-31081827 TTCTGTATTTTTAGTAAAGAAGG + Intergenic
1146578664 17:34016250-34016272 TTTTGTGTTTTTAGTAAAGACGG - Intronic
1146899820 17:36576166-36576188 TTTTGTGTTTTTAGTGCAGATGG - Intronic
1146996919 17:37329098-37329120 AACTGTGTTTCTAGAGAAAAAGG + Intronic
1147204447 17:38826658-38826680 TTTTGTGTTTGTAGTAAAGATGG + Intergenic
1147345978 17:39795575-39795597 TTTTGTGTTTTTAGTAAAGACGG + Intronic
1147414729 17:40280296-40280318 TTTTGTGTTTTTAGTGGAGACGG - Exonic
1147800337 17:43081167-43081189 GTCTGTGTTTAGACTGAAGATGG + Intronic
1147802430 17:43102241-43102263 TTCTGTGTTTTTAGTAGAGACGG + Intronic
1148158866 17:45438725-45438747 TTTTGTGTTTTTAGTGGAGACGG + Intronic
1148176877 17:45573749-45573771 TTATGTGTTAATAAAGAAGGGGG + Intergenic
1148177868 17:45583566-45583588 TTCTGTGTGTAAACAGAAGAGGG + Intergenic
1148530954 17:48390902-48390924 TTTTGTATTTTTAGTGAAGACGG - Intronic
1148895512 17:50836945-50836967 TTCGGTGTTAATAGACAGGATGG - Intronic
1148962418 17:51404355-51404377 TTTTGTATTTATAGTAAAGATGG - Intergenic
1149100954 17:52906374-52906396 TGCTGGGTTAATAGAGAAAACGG - Intergenic
1149225023 17:54459971-54459993 TTCTTTGTTCATAGTGAAGTTGG - Intergenic
1149458340 17:56807635-56807657 GTTTGTGTTTAGAGGGAAGAAGG - Intronic
1149460983 17:56830169-56830191 TTTTGTGTTTTTAGTGGAGACGG - Intronic
1149609212 17:57947626-57947648 TTTTGTGTTTTTAGTAAAGATGG - Intronic
1149647811 17:58252849-58252871 TTTTGTGTTTTTAGAAGAGACGG - Intronic
1149947377 17:60945268-60945290 TGCTGTGTTAATAGATCAGAAGG + Intronic
1150055743 17:62013866-62013888 TTTTGTGTTTTTAGTGGAGACGG - Intronic
1150076916 17:62200424-62200446 TTTTGTATTTTTAGTGAAGACGG - Intergenic
1150252232 17:63712828-63712850 TTTTGTATTTTTAGAAAAGACGG - Intronic
1150390220 17:64785807-64785829 TTTTGTGTTTTTAGTGGAGACGG + Intergenic
1150560553 17:66290636-66290658 TACTGTCTTCATGGAGAAGAGGG - Intergenic
1150560764 17:66292743-66292765 TACTGTCTTCATGGAGAAGAGGG - Intergenic
1150768099 17:68018708-68018730 TTTTGTGTTTTTAGTAAAGACGG + Intergenic
1150792129 17:68207250-68207272 TTCTGTGTGAAAACAGAAGAGGG - Intergenic
1150827219 17:68487628-68487650 TTTTGTGTTTTTAGTAAAGATGG - Intergenic
1151133808 17:71925448-71925470 TTTTGTGTTTTTAGTAAAGACGG + Intergenic
1151274762 17:73025945-73025967 TTTTGTGTTTTTAGTGGAGACGG - Intronic
1151299409 17:73211687-73211709 TTTTGTGTTTTTAGTGGAGATGG - Intronic
1151311327 17:73294178-73294200 TTCTGTGTTTTTAGTGGAGATGG - Intronic
1151332382 17:73418176-73418198 TTTTGTATTTTTAGTGAAGATGG + Intronic
1151467727 17:74298475-74298497 TTTTGTGTTTTTAGTAAAGATGG + Intronic
1151507032 17:74535294-74535316 TTTTGTATTTTTAGTGAAGACGG - Intergenic
1151617625 17:75224659-75224681 TTTTGTGTTTTTAGTAAAGATGG - Intronic
1151632043 17:75317694-75317716 TTCTGTGTTAAACAAGAAGAAGG - Intergenic
1151663049 17:75529543-75529565 TTTTGTTTTTAAAGAGATGAAGG - Intronic
1151677797 17:75608287-75608309 TTTTGTGTTTTTAGTGGAGATGG + Intergenic
1151762534 17:76114068-76114090 TTTTGTGTTTTTAGTGGAGATGG - Intronic
1151880568 17:76892216-76892238 TTCTGTATTTTTAGGGGAGATGG + Intronic
1151931229 17:77232972-77232994 TTCTGTATTTTTAGTAAAGATGG - Intergenic
1152088671 17:78235082-78235104 TTTTGTGTTTTTAGTAAAGATGG - Intronic
1153761429 18:8335849-8335871 TTTTGTGTTTATAGTAGAGATGG - Intronic
1153913368 18:9723216-9723238 TTTTGTGTTTTTAGTGGAGATGG + Intronic
1153925260 18:9830183-9830205 TTATGTGTTTGTAGAGATGGGGG + Intronic
1154215989 18:12416486-12416508 TTCTGTTTTTGTAGAGATGAGGG + Intronic
1154238889 18:12633404-12633426 TTTTGTATTTTTAGTGAAGACGG - Intronic
1154247067 18:12708880-12708902 TTTTGTGTTTTTAGTAAAGATGG + Intronic
1154496510 18:14965124-14965146 CTATCTGTTTAGAGAGAAGATGG - Intergenic
1155044946 18:22095353-22095375 TTTTGTGTTTTTAGTAAAGATGG + Intronic
1155134450 18:22974628-22974650 TTTTGTGTTTTTAGTGGAGACGG + Intronic
1155459312 18:26058984-26059006 TTCTGTTTTCAGACAGAAGAGGG - Intronic
1155551697 18:26972184-26972206 TTTTGTGTTTTTAGTGGAGATGG - Intronic
1155917630 18:31571997-31572019 TGCTCTGTCTTTAGAGAAGAGGG + Intergenic
1155937021 18:31764712-31764734 TTCTGTGTTTTTAGTAGAGATGG + Intergenic
1155944455 18:31832861-31832883 CTTTGTGTTTATAGAGTAAAAGG - Intronic
1156151038 18:34243243-34243265 TTTTGTATTTTTAGTGAAGATGG + Intergenic
1156259404 18:35430709-35430731 ATCTCTGTTTAGAGAGAAAAAGG - Intergenic
1156620695 18:38848024-38848046 TTATAAGTTTATAGAAAAGAGGG - Intergenic
1156738211 18:40290130-40290152 TTGTGTGTTTTTAGTAAAGACGG - Intergenic
1156951511 18:42905641-42905663 TTTTGTGTTTTTAGTGGAGATGG + Intronic
1157213022 18:45760061-45760083 TTCTGTATTTATATAAAATATGG - Intergenic
1157229284 18:45898952-45898974 TTCTGTGTTTTTAGTAGAGATGG - Intronic
1157343501 18:46802381-46802403 TTCTGTGTTTTTAGTAGAGAAGG - Intergenic
1157478104 18:48036243-48036265 TTCTGTGGGTCTAGAGAGGAGGG - Intronic
1157980487 18:52374062-52374084 TTTTGTGTTTTTAGTAAAGACGG + Intronic
1158112720 18:53959182-53959204 TTCTGTGTGGATTGAGAAGAAGG - Intergenic
1158285814 18:55881375-55881397 TGGTGTATTTATAGAAAAGATGG + Intergenic
1158385190 18:56981529-56981551 TTCAGTGTTTAGAGATAAGATGG + Intronic
1158426409 18:57343970-57343992 CCCTGTGGTTATAGAGAAAAGGG + Intergenic
1158623056 18:59049157-59049179 TTGTGTGCTTATAGAGAAATAGG - Intergenic
1158689585 18:59648533-59648555 TTTTGTGTTTTTAGTAAAGATGG - Intronic
1158844524 18:61427832-61427854 TTTAGTTTTTGTAGAGAAGAGGG - Intronic
1159170249 18:64756926-64756948 TCCTGTATTTATAGACAATATGG + Intergenic
1159252306 18:65895527-65895549 TTCTGTATTTTTAGTGGAGATGG - Intergenic
1159342081 18:67147917-67147939 TTTTGTGTTTTTAGTAAAGACGG + Intergenic
1159548112 18:69866371-69866393 TTCTGGGTTTGCAGATAAGAGGG - Intronic
1159771485 18:72550495-72550517 TACAGAGTTTATGGAGAAGATGG + Intronic
1160410311 18:78671225-78671247 TGCTGTGATCAGAGAGAAGACGG - Intergenic
1160862359 19:1242818-1242840 TTCTGTATTTTTAGAAGAGACGG - Intronic
1161259159 19:3326764-3326786 TTTTGTGTTTTTAGTGGAGATGG - Intergenic
1161312329 19:3601754-3601776 TTTTGTATTTTTAGTGAAGATGG - Intronic
1161826029 19:6566318-6566340 TTTTGTGTTTTTAGTAAAGATGG + Intergenic
1161845402 19:6709275-6709297 TTTTGTATTTTTAGTGAAGACGG - Intronic
1161854991 19:6759281-6759303 TTTTGTGTTTTTAGTGGAGATGG + Intronic
1162037640 19:7950619-7950641 TTTTGTGTTTTTAGTAAAGACGG - Intergenic
1162074724 19:8178043-8178065 TTTTGTATTTATATTGAAGACGG + Intronic
1162196602 19:8989665-8989687 TTTTGTATTTGTAGTGAAGACGG - Intergenic
1162198874 19:9007041-9007063 TTTTGTGTTTTTAGTAAAGATGG - Intergenic
1162324717 19:9992250-9992272 TTTTGTGTTTTTAGTAAAGACGG - Intronic
1162662045 19:12177517-12177539 TTTTGTGTTTTTAGTGGAGATGG + Intronic
1162690301 19:12424465-12424487 TTTTGTGTTTATAGTAGAGATGG - Intronic
1162700211 19:12509371-12509393 TTCTGTATTTTTAGTAAAGACGG + Intronic
1162768587 19:12935403-12935425 TTTTGTGTTTTTAGAGGAGATGG - Intergenic
1163038583 19:14586292-14586314 TTTTGTATTTTTAGAAAAGATGG + Intronic
1163039277 19:14590555-14590577 TTTTGTATTTTTAGAAAAGATGG + Intronic
1163071868 19:14849626-14849648 TTTTGTATTTTTAGTGAAGATGG + Intergenic
1163480614 19:17554041-17554063 TTTTGTGTTTTTAGAAGAGATGG + Intergenic
1163527868 19:17832089-17832111 TTTTGTGTTTTTAGTGGAGATGG - Intronic
1163580682 19:18136990-18137012 TTTTGTGTTTTTAGAAGAGATGG + Intronic
1163604771 19:18267966-18267988 TTCTGTATTTTTAGTAAAGACGG + Intronic
1163816792 19:19471083-19471105 TTCTGTATTTTTAGTGGAGACGG - Intronic
1163820372 19:19493109-19493131 TTTTGTGTTTTTAGTGGAGACGG + Intronic
1163905062 19:20145025-20145047 TTTTGTATTTTTAGTGAAGACGG + Intergenic
1164001230 19:21101311-21101333 CTCTGGGTTTGTAGTGAAGAGGG + Intronic
1164007994 19:21169514-21169536 CTCTGGGTTTGTAGTGAAGAGGG + Intronic
1164031310 19:21408297-21408319 TTGTGTGTTTTTAGTGGAGACGG + Intronic
1164066167 19:21719177-21719199 TTTTGTGTTTTTAGTAAAGACGG - Intergenic
1164239620 19:23373072-23373094 ATCTGGGTTTGTAGTGAAGAAGG - Intronic
1164253284 19:23503658-23503680 CTCTGGGTTTGTAGTGAAGAGGG - Intergenic
1164297140 19:23922048-23922070 CTCTGGGTTTGTAGTGAAGAGGG + Intronic
1164317628 19:24107842-24107864 CTCTGGGTTTGTAGTGAAGAGGG + Intronic
1164373113 19:27658604-27658626 TTCTGTGTTTTTAGTAGAGACGG - Intergenic
1164971366 19:32535746-32535768 TTCTGTGTTTATAAAGGTGTGGG - Intergenic
1165162707 19:33827193-33827215 TTCTGTATTTTTAGTAAAGATGG + Intergenic
1165304769 19:34996634-34996656 TTTTGTGTTTTTAGTCAAGATGG - Intronic
1165643313 19:37408852-37408874 TACTGTGTTTATGGAGTGGAAGG + Intergenic
1165828013 19:38716657-38716679 TTAAGTTTTTATAGAGAAGGGGG - Intronic
1166009663 19:39933124-39933146 TTCTGTTTTTAAAGAGAATGTGG + Intronic
1166190518 19:41173559-41173581 TTGTGTATTTATAGTGGAGATGG - Intergenic
1166437278 19:42778170-42778192 CTGTGTGTTTGCAGAGAAGATGG - Intronic
1166446988 19:42866615-42866637 CTGTGTGTTTGCAGAGAAGATGG - Intronic
1166453917 19:42924284-42924306 CTGTGTGTTTGCAGAGAAGATGG - Exonic
1166456389 19:42943566-42943588 CTGTGTGTTTGCAGAGAAGATGG - Intronic
1166466181 19:43032837-43032859 CTGTGTGTTTGCAGAGAAGATGG - Intronic
1166472325 19:43088905-43088927 CTGTGTGTTTGCAGAGAAGATGG - Intronic
1166483456 19:43192854-43192876 CTGTGTGTTTGCAGAGAAGATGG - Exonic
1166485926 19:43211941-43211963 CTGTGTGTTTGCAGAGAAGATGG - Intronic
1166493082 19:43275894-43275916 CTGTGTGTTTGCAGAGAAGATGG - Intergenic
1166559584 19:43723266-43723288 TTTTGTGTTTTTAGTGGAGATGG - Intergenic
1166600301 19:44088081-44088103 TTTTGTATTTTTAGTGAAGATGG + Exonic
1166973973 19:46592590-46592612 TTCTGTGTTTTTAGTAGAGATGG - Intronic
1167047914 19:47061991-47062013 TTCTGTATTTTTAGTAAAGATGG + Intergenic
1167055091 19:47105428-47105450 TTCTGTGTTTTTAGTAGAGATGG - Intronic
1167084450 19:47299814-47299836 TTCTGTATTTTTAGAAGAGACGG + Intronic
1167088597 19:47327862-47327884 TTCTGTATTTTTAGTGGAGACGG + Intergenic
1167205719 19:48100344-48100366 TTCTGTATTTTTAGTGGAGACGG - Intronic
1167219021 19:48185303-48185325 TTTTGTGTTTTTAGAAGAGACGG + Intronic
1167335271 19:48881553-48881575 TTCTGTGTTTTTAGTAGAGACGG + Intronic
1167431996 19:49460582-49460604 TTTTGTGTTTTTAGTGGAGATGG + Intronic
1167757098 19:51419571-51419593 TTTTGTATTTTTAGAAAAGATGG + Intergenic
1167846233 19:52167009-52167031 TCCTTTGTTATTAGAGAAGATGG - Intronic
1167910223 19:52695813-52695835 TTCTGTATTTTTAGTAAAGATGG + Intergenic
1167911577 19:52707803-52707825 TTTTGTGTTTTTAGTAAAGATGG + Intronic
1167918015 19:52757954-52757976 TTCTGTATTTTTAGTAAAGATGG + Intergenic
1167938707 19:52928109-52928131 TTTTGTATTTATAGTGGAGATGG - Intergenic
1167989916 19:53349862-53349884 TTTTGTGTTTTTAGTAAAGATGG - Intronic
1167994918 19:53394665-53394687 TGCTGTGTTTATCCAGAAGGTGG + Intronic
1168021625 19:53612984-53613006 GTCAGTGTTTACAGGGAAGATGG + Intergenic
1168029771 19:53670232-53670254 TTTTGTGTTTTTAGTGGAGATGG + Intergenic
1168040582 19:53755529-53755551 TTTTGTATTTTTAGTGAAGACGG + Intergenic
1168151014 19:54448759-54448781 TTTTGTGTTTTTAGTAAAGACGG - Intergenic
1168165156 19:54542182-54542204 TTTTGTGTTTTTAGTGGAGACGG + Intronic
1168506026 19:56935837-56935859 TTTTGTGTTTTTAGTAAAGACGG + Intergenic
1168618829 19:57860437-57860459 TTTTGTGTTTTTAGTGGAGATGG + Exonic
925311321 2:2885536-2885558 TTCTGTATTTTTAGTAAAGACGG - Intergenic
925480186 2:4261863-4261885 GTAAGTGTTTATAGAAAAGAAGG + Intergenic
925573558 2:5336708-5336730 TTCTGTGTTTTTAGTAGAGACGG - Intergenic
925873506 2:8292187-8292209 TTTTGTGTTTATAGTAGAGATGG - Intergenic
925990775 2:9252408-9252430 TTCTGTATTTTTAGTAAAGATGG - Intronic
926445831 2:12941983-12942005 TTCTGTATTTTTAGTGGAGATGG - Intergenic
926503915 2:13687120-13687142 TTTTGTGTTTTTAGTAAAGATGG - Intergenic
926684160 2:15685660-15685682 TTTTGTGTTTTTAGTAAAGATGG - Intergenic
926710855 2:15879155-15879177 TTCTGTGTTTTTAGTAGAGACGG - Intergenic
927377225 2:22432167-22432189 TTTTGTGTTCTTAGTGAAGATGG - Intergenic
927628701 2:24751410-24751432 TTTTGTATTTTTAGAGGAGACGG - Intronic
927775884 2:25902817-25902839 TTCTGTGTTTTTAGTAGAGATGG + Intergenic
927804494 2:26134106-26134128 TTCGGTGTTTTTAGAGGAGTTGG + Intronic
928299958 2:30116304-30116326 TTTTGTTTTTATAGAAGAGATGG + Intergenic
928516535 2:32049808-32049830 TTCTGTATTTTTAGTGGAGACGG + Intergenic
928520933 2:32088056-32088078 TTTTGTATTTTTAGTGAAGATGG + Intronic
928523048 2:32109277-32109299 TTTTGTGTTTTTAGTAAAGATGG + Intronic
928569232 2:32586587-32586609 TTTTGTGTTTATAGTAGAGATGG + Intronic
928851610 2:35754163-35754185 TTCTGTGTTTTTAGTAGAGACGG - Intergenic
929173592 2:38955845-38955867 TTTTGTGTTTTTAGTGGAGATGG + Intronic
929183596 2:39069716-39069738 TTCTGTATTTTTAGTGGAGACGG + Intronic
929298747 2:40277367-40277389 TTTTGTGTTTTTAGTGGAGACGG - Intronic
929431114 2:41887422-41887444 TTTTGTGTTTATAGTAGAGATGG - Intergenic
929463834 2:42127088-42127110 TTCTGTATTTTTAGAAGAGATGG + Intergenic
929509386 2:42554978-42555000 TTTTGTATTTTTAGTGAAGACGG - Intronic
929774123 2:44917561-44917583 TTGTGTGTTTTTATGGAAGAGGG + Intergenic
929820055 2:45266006-45266028 TTTTGTGTTTTTAGTGGAGACGG + Intergenic
929892888 2:45933646-45933668 TTTTGTGTTTTTAGTGGAGACGG + Intronic
929997585 2:46838476-46838498 TTTTGTGTTTTTAGTGGAGATGG + Intronic
930000395 2:46857392-46857414 TTTTGTGTTTTTAAAGGAGACGG - Intronic
930124731 2:47786503-47786525 TTTTGTGTTTATAGTAGAGACGG + Intronic
930206613 2:48593285-48593307 TTTTGTGTTTATAGTAGAGATGG + Intronic
930906795 2:56578939-56578961 TTCTGTATCTATTGAGATGATGG - Intergenic
930952727 2:57162978-57163000 TTCTGTATTTTTAGTAAAGACGG - Intergenic
931368890 2:61643638-61643660 TTTTGTATTTTTAGAGGAGACGG + Intergenic
931611579 2:64107097-64107119 TTTTGTATTTTTAGTGAAGATGG + Intronic
931623753 2:64236548-64236570 TTCTGTATTTTTAGTGGAGATGG - Intergenic
931726922 2:65120283-65120305 TTTTGTATTTATAGTAAAGACGG - Intronic
931859629 2:66341311-66341333 TTCTGTATTTTTAGTAAAGATGG + Intergenic
932211026 2:69930572-69930594 TTCTGTGTTTCCATAGAAAATGG + Intronic
932376716 2:71242328-71242350 TTTTGTGTTTATAGTAGAGATGG - Intergenic
932505988 2:72232899-72232921 TTTTGTGTTTATAGTAGAGACGG - Intronic
932810551 2:74822238-74822260 TTTTTTTTTTAGAGAGAAGAAGG - Intergenic
932915185 2:75850244-75850266 TTCTGTGTTTTTAGTAGAGACGG - Intergenic
932942749 2:76188231-76188253 TTCTGTGTATTTAGAGAAGGAGG + Intergenic
933706428 2:85294206-85294228 TTTTGTGTTTTTAGTAAAGACGG + Intronic
933836886 2:86253109-86253131 TTTTGTATTTTTAGAGGAGATGG - Intronic
934697716 2:96412124-96412146 TTTTGTATTTATAGTAAAGATGG + Intergenic
934741523 2:96726911-96726933 TTTTGTGTTTTTAGTGGAGACGG - Intronic
935118794 2:100161579-100161601 TTCTGTATTTTTAGTGGAGATGG - Intergenic
935165440 2:100565136-100565158 TTTTGTGTTTTTAGTGGAGATGG + Intronic
935165492 2:100565444-100565466 TTTTGTGTTTTTAGTAAAGACGG + Intronic
935209750 2:100929073-100929095 TTTTGTATTTTTAGTGAAGACGG + Intronic
935343222 2:102077239-102077261 TTTTGTATTTTTAGAGATGATGG + Intronic
935429576 2:102960677-102960699 TTTTGTGTTTTTAGTGAACACGG - Intergenic
935610961 2:105025094-105025116 TTTTGTGTTTTTAGAAGAGACGG + Intergenic
935790762 2:106587934-106587956 TTTTGTATTTTTAGTGAAGACGG - Intergenic
935869654 2:107432387-107432409 TAATGTATTTATAGAGAAAATGG - Intergenic
935921578 2:108021493-108021515 TGCTTTGTTTATAGAGGAGAAGG - Intergenic
936086189 2:109471047-109471069 TTTTGTGTTTTTAGTGGAGATGG - Intronic
936133020 2:109863539-109863561 TTCTGTGTTTTTAGTAGAGACGG - Intergenic
936211677 2:110507946-110507968 TTCTGTGTTTTTAGTAGAGACGG + Intergenic
936420816 2:112362523-112362545 TTCTGTGTTTTTAGTAGAGACGG + Intergenic
936577114 2:113666404-113666426 TTCTGTGTTTTTAGTAGAGATGG + Intergenic
936663014 2:114563199-114563221 TTTTGTGTTTTTAGTAAAGATGG - Intronic
936732072 2:115394777-115394799 TTCTCTGTTTATAGTGAGGTGGG + Intronic
936943912 2:117913744-117913766 TTTTGTATTTATAGTAAAGACGG + Intergenic
937105607 2:119309588-119309610 TTTTGTATTTTTAGTGAAGATGG + Intronic
937123591 2:119458427-119458449 TTTTGTGTTTTTAGTGGAGACGG - Intronic
937393402 2:121513435-121513457 TTTTTTTTTTAAAGAGAAGAAGG + Intronic
937559554 2:123205397-123205419 TTCTGTTTTTCTCAAGAAGAGGG + Intergenic
938075950 2:128336976-128336998 TTCTGTATTTATTGAGATGATGG - Intergenic
938377339 2:130816743-130816765 TTTTGTGTTTTTAGTAAAGACGG + Intergenic
938608091 2:132917374-132917396 TTCTGATGTTATACAGAAGAGGG + Intronic
938703113 2:133897025-133897047 TTCTGTTTGTACAGAGAAAAAGG + Intergenic
938859166 2:135348762-135348784 TTTTGTGTTTTTAGTAAAGATGG + Intronic
939108347 2:137976093-137976115 TTTTGTGTTTTTAGAAAAGCCGG - Intronic
939227790 2:139385548-139385570 TTTTCTGTGTATAAAGAAGATGG + Intergenic
939321101 2:140623746-140623768 TTCTGTATTTTTAGAAGAGATGG - Intronic
939416848 2:141911034-141911056 TTCTGTATTTATACAGAACTAGG + Intronic
939615482 2:144357469-144357491 TTTTGTGTTTTTAGTGGAGATGG + Intergenic
939962937 2:148581849-148581871 TCTTGTGTTTATTGAGAACATGG - Intergenic
940223287 2:151376072-151376094 TTTTGTGTTTTTAGTAAAGATGG - Intronic
940835312 2:158514768-158514790 TTTTGTGTTTATAGTAGAGATGG - Intronic
940843839 2:158618010-158618032 TTCTGTATTTTTAGTAAAGATGG - Intronic
940884188 2:158974601-158974623 TTTTGTGTTTTTAGTAAAGATGG + Intronic
940917784 2:159276230-159276252 TTCTGTGTTTTTAGTAGAGACGG + Intronic
940957591 2:159745482-159745504 TTTTGTATTTTTAGTGAAGATGG - Intronic
941407031 2:165102641-165102663 TTGTGTGTTGTTAGAGAAGCTGG + Intronic
941507164 2:166360793-166360815 TTCAGTCTGTATAGGGAAGAAGG - Intronic
941676008 2:168344209-168344231 TTCTGTATTTTTAGTAAAGATGG - Intergenic
941749592 2:169120606-169120628 TTTTGTGTTTTTAGTAAAGAGGG - Intergenic
941797390 2:169615217-169615239 TTCTGTATTTTTAGTGGAGATGG + Intronic
941878927 2:170462106-170462128 TCCTGGGTTTAGAAAGAAGAGGG - Intronic
941885654 2:170524652-170524674 TTTTGTGTTTTTAGTGGAGATGG + Intronic
941948066 2:171122115-171122137 TTTTGTATTTTTAGTGAAGACGG + Intronic
941989003 2:171536474-171536496 TTTTGTGTTTTTAGTGGAGACGG + Intronic
942175388 2:173328897-173328919 TTCTGTGTTTTTAGTAGAGATGG + Intergenic
942586452 2:177484514-177484536 TTTTGTATTTTTAGTGAAGATGG + Intronic
942758464 2:179369726-179369748 TTTTGTGTTTTTAGTGGAGATGG + Intergenic
943014114 2:182490543-182490565 TTTTGTATTTTTAGTGAAGACGG + Intronic
943311573 2:186332146-186332168 GTCTCTGTTTATAGCAAAGAGGG - Intergenic
944115790 2:196184789-196184811 TTTTGTATTTTTAGTGAAGACGG - Intergenic
944178783 2:196863747-196863769 TTTTGTGTTTTTAGCAAAGACGG + Intronic
944237551 2:197453770-197453792 TTCCGTGTCTTTAGAGGAGAAGG + Intronic
944404057 2:199361907-199361929 TTTTGTGTTTTTAGTAAAGATGG + Intronic
944481863 2:200165403-200165425 TTTTGTGTTTTTAGTGGAGATGG - Intergenic
944643316 2:201751021-201751043 TTCTGTGTTTTTAGTAGAGATGG + Intronic
944713623 2:202358031-202358053 TTTTGTATTTTTAGTGAAGATGG + Intergenic
944745293 2:202649720-202649742 TTTTGTGTTTTTAGTAAAGACGG + Intronic
945228746 2:207561236-207561258 TTCCATGTTTATAGAGGAAAAGG - Intronic
945231677 2:207596602-207596624 TTTTGTGTTTATAGTAGAGAGGG + Intronic
945469910 2:210215852-210215874 CTCTGTGCTTATTGAGGAGAAGG - Intronic
945489496 2:210438303-210438325 TTTTGTGTTTTTAGTAAAGACGG + Intronic
945617853 2:212095758-212095780 TTCTGTGTTTTTAGTAGAGACGG - Intronic
945980076 2:216302725-216302747 TTTTGTGTTTTTAGTGGAGACGG - Intronic
946275022 2:218624938-218624960 TTTTGTGTTTTTAGTGGAGATGG - Intronic
946426416 2:219600278-219600300 TTTTGTGTTTTTAGTGGAGACGG + Intronic
946462609 2:219882448-219882470 TTGTGTGTTTTTAGTGGAGACGG + Intergenic
946734698 2:222742754-222742776 TTTTGTGTTTTTAGTGGAGATGG + Intergenic
946793047 2:223320825-223320847 TTTTGTGTTTTTAGTGGAGATGG + Intergenic
946964484 2:225023204-225023226 TTTTGTGTTTTTAGTGGAGACGG + Intronic
947606462 2:231489279-231489301 TTTTGTGTTTTTAGTAAAGATGG + Intergenic
947626792 2:231624303-231624325 TTTTGTGTTTTTAGTAAAGACGG + Intergenic
948162712 2:235838010-235838032 TTTTGTGTTTTTAGTAAAGATGG - Intronic
948379445 2:237542365-237542387 TTCTGTGGTTGTTGAGAAGGGGG - Intronic
948931263 2:241133810-241133832 TTTTGTGTTTTTAGTGGAGACGG - Intronic
948969958 2:241417839-241417861 TTGTGTGTTTAGAGGGCAGATGG - Intronic
949051483 2:241899893-241899915 TTTTGTATTTTTAGTGAAGACGG - Intronic
1168761925 20:355175-355197 TTTTGTATTTATAGTGGAGACGG + Intronic
1168903271 20:1383981-1384003 TTCTGTGTCTAATAAGAAGAGGG - Intronic
1168986834 20:2056277-2056299 TTTTGTATTTTTAGCGAAGACGG - Intergenic
1169170766 20:3463108-3463130 TTCTTTGTTTTTAGAGATGGGGG + Intergenic
1169256020 20:4099731-4099753 TTTTGTGTTTTTAGTAAAGACGG + Intergenic
1169831176 20:9827150-9827172 TTGTGTGTTTTTAAAGAAAATGG + Intronic
1170066294 20:12314261-12314283 TTCTGTGTTTCCAGTGAAAAGGG + Intergenic
1170377632 20:15718157-15718179 TTTTGTGTTTTTAGTGGAGATGG + Intronic
1170457938 20:16550954-16550976 TCCTGTGTTTTGAGAGAAGTGGG - Intronic
1170470960 20:16667507-16667529 TTTTGTGTTTTTAGTGGAGATGG - Intergenic
1170831722 20:19848360-19848382 TTGTGTGTTTTTAGTAAAGACGG - Intergenic
1171215450 20:23349328-23349350 TTCTGATTTTATAGACAAGGAGG - Intergenic
1171499679 20:25584300-25584322 TTTTGTGTTTTTAGTGGAGATGG - Intronic
1171856609 20:30350220-30350242 TCATGTGTTCATAGAGTAGAGGG - Intergenic
1171889626 20:30698568-30698590 TTTTGTGTTTATAGTAGAGATGG + Intergenic
1172241321 20:33414420-33414442 TTTTGTGTTTTTAGAGGAGATGG - Intronic
1172247514 20:33456145-33456167 TTCTTTGTTTTTGGAGAAGGGGG + Intergenic
1172247626 20:33456828-33456850 TTCTTTGTTTTTGGAGAAGGGGG + Intergenic
1172325054 20:34028113-34028135 TTTTGTGTTTTTAGTGGAGACGG - Intronic
1172358722 20:34297466-34297488 TTTTGTATTTTTAGAGGAGACGG + Intronic
1172365154 20:34343470-34343492 TTTTGTATTTTTAGTGAAGACGG + Intergenic
1172524120 20:35587316-35587338 TTCTGTATTTTTAGTAAAGATGG - Intergenic
1173058659 20:39640523-39640545 TTTTGTATTTTTAGACAAGATGG - Intergenic
1173113051 20:40213426-40213448 TTTTGTGTTTTTAGTGGAGATGG - Intergenic
1173420450 20:42896463-42896485 TTTTGTATTTTTAGTGAAGACGG - Intronic
1173474042 20:43346015-43346037 TTTTGAGTTTATTTAGAAGATGG - Intergenic
1173573588 20:44095231-44095253 TTTTGTGTTTTTAGTGGAGATGG - Intergenic
1173820275 20:46015002-46015024 TGGGGTGTTTATAAAGAAGATGG - Intronic
1174307568 20:49625171-49625193 TTTTGTGTTTTTAGTAAAGACGG + Intergenic
1174377373 20:50135010-50135032 TTTTGTGTTTTTAGTAAAGACGG - Intronic
1174454388 20:50639069-50639091 TTCTGTGTTTTTAGTAGAGATGG - Intronic
1174472409 20:50770678-50770700 TTCTGTGTTTTTAGTAGAGATGG + Intergenic
1174487144 20:50868593-50868615 TTTTGTTTTTATAGAGATGGGGG + Intronic
1174489397 20:50881829-50881851 TTTTGTGTTTTTAGTAAAGATGG + Intronic
1174623752 20:51897253-51897275 TTTTGTGTTTTTAGTGGAGATGG - Intergenic
1174743516 20:53039606-53039628 TTTTGTGTTTTTAGTGGAGACGG - Intronic
1174767393 20:53266946-53266968 TTCTGTGTTTTTAGTACAGAAGG + Intronic
1174805762 20:53603255-53603277 TTTTGTATTTTTAGAGGAGACGG - Intronic
1174844108 20:53926960-53926982 TTCTGGATTTATTTAGAAGATGG - Intergenic
1174904137 20:54532362-54532384 TTCTGTGTTTATAGAGAAGAAGG + Intronic
1175111820 20:56653785-56653807 TTCTGAGTTTATGGATAACATGG + Intergenic
1176262634 20:64190501-64190523 TTTTGTGTTTTTAGTAAAGACGG - Intronic
1176262684 20:64190796-64190818 TTTTGTGTTTTTAGTAAAGACGG - Intronic
1176337657 21:5613873-5613895 TTTTGTGTTTTTAGTGGAGACGG + Intergenic
1176383433 21:6125350-6125372 TTCTGTATTTTTAGTGGAGATGG + Intergenic
1176471319 21:7109099-7109121 TTTTGTGTTTTTAGTGGAGACGG + Intergenic
1176494880 21:7490877-7490899 TTTTGTGTTTTTAGTGGAGACGG + Intergenic
1176505762 21:7647506-7647528 TTTTGTGTTTTTAGTGGAGACGG - Intergenic
1176582607 21:8545388-8545410 TTTTGTGTTTTTAGTAAAGATGG - Intergenic
1176676730 21:9785568-9785590 TTTTGTGTTTTTAGGAAAGATGG + Intergenic
1176690897 21:9907547-9907569 TTTTGTGTTTTTAGTAAAGATGG + Intergenic
1176733050 21:10519482-10519504 TTTTGTTTTTTTAGAGGAGACGG + Intergenic
1177073944 21:16548659-16548681 TTCTGTATTTTTAGTGGAGATGG + Intergenic
1177156694 21:17508021-17508043 TTTTGTGTTTATAGTAGAGACGG - Intergenic
1177345409 21:19862076-19862098 TTCTGTGTTTTTAGTAGAGACGG + Intergenic
1177394737 21:20518469-20518491 TTTTGTGTTTTTAGAAGAGATGG + Intergenic
1177627580 21:23683760-23683782 TTTTGTGTTTTTAGTGGAGACGG + Intergenic
1177705200 21:24695254-24695276 TTTTGTATTTTTAGTGAAGATGG + Intergenic
1177803909 21:25855405-25855427 TTTTGTATTTATAGTGGAGACGG - Intergenic
1177819531 21:26016201-26016223 TTTTGTATTTTTAGTGAAGACGG + Intronic
1178174503 21:30080992-30081014 TTGTGTTTTAATAGAGATGAGGG + Intergenic
1178272382 21:31203291-31203313 TTTTGTGTTTTTAGTGGAGATGG + Intronic
1178291082 21:31369052-31369074 TTCTGTGTTTTTAGTAGAGATGG - Intronic
1178319633 21:31595620-31595642 TTTTGTATTTTTAGTGAAGATGG + Intergenic
1178586111 21:33872700-33872722 TTTTGTGTTTTTAGTGGAGACGG + Intronic
1178670406 21:34585569-34585591 TTTTGTGTTTTTAGTGGAGACGG - Intronic
1178777944 21:35570052-35570074 TTCTGTGTTTTTAGTAGAGACGG + Intronic
1178813743 21:35908163-35908185 TTTTGTATTTTTAGTGAAGATGG + Intronic
1179301795 21:40118414-40118436 TTCTGTGGTTTTAGTGGAGATGG - Intronic
1179350790 21:40609123-40609145 TTTTGTATTTTTAGAAAAGATGG + Intronic
1179573951 21:42295148-42295170 TTTTGTGTTTTTAGTGGAGACGG - Intronic
1179579289 21:42330155-42330177 TACTTTGTTCAAAGAGAAGAAGG + Intergenic
1180265438 22:10522436-10522458 TTTTGTGTTTTTAGTAAAGATGG - Intergenic
1180579821 22:16823051-16823073 TTTTGTGTTTTTTGAGGAGATGG + Intergenic
1180671193 22:17554869-17554891 TTCTGTGTTTGTGCAGAAGCAGG + Intronic
1180761556 22:18213493-18213515 TTTTGTGTTTTTATAGAAAAGGG - Intergenic
1180774111 22:18411117-18411139 TTTTGTGTTTTTATAGAAAAGGG + Intergenic
1180986757 22:19909032-19909054 TTTTGTGTTTTTAGTGGAGATGG - Intronic
1181070220 22:20330130-20330152 TTTTGTGTTTTTATAGAAAAGGG + Intergenic
1181193214 22:21158067-21158089 TTTTGTGTTTTTATAGAAAAGGG + Intergenic
1181216231 22:21334534-21334556 TTTTGTGTTTTTATAGAAAAGGG - Intergenic
1181674589 22:24443512-24443534 TTCTGTGTTTTTAGTAGAGATGG + Intergenic
1181783464 22:25209122-25209144 TTTTGTGTTTTTAGAAGAGATGG + Intergenic
1182005455 22:26955931-26955953 TTTTGTATTTTTAGAAAAGACGG - Intergenic
1182034947 22:27190598-27190620 TTTTGTATTTTTAGTGAAGATGG - Intergenic
1182166978 22:28185235-28185257 TTCTGTGTAGACAGACAAGATGG - Intronic
1182209107 22:28659437-28659459 TTTTGTGTTTTTAGTGGAGATGG + Intronic
1182359199 22:29736850-29736872 TTGTGTGTTTTTAGTGGAGACGG - Intronic
1182379507 22:29875653-29875675 TTCTGTGTCTATTGAGATGATGG + Intergenic
1182657267 22:31900566-31900588 TTTTGTGTTTTTAGTAAAGATGG - Intronic
1183207260 22:36428025-36428047 TTTTGTATTTTTAGTGAAGACGG - Intergenic
1183416184 22:37683362-37683384 TTATTTATTTATAGAGATGAGGG - Intronic
1183597404 22:38821062-38821084 TTTTGTATTTTTAGTGAAGATGG + Exonic
1183770520 22:39921529-39921551 TTTTGTGTTTGTGGAGAAGGAGG + Intronic
1183835077 22:40445718-40445740 TTCTGTATTTTTAGTAAAGACGG + Intronic
1183882779 22:40849303-40849325 TTTTGTGTTTTTAGTGGAGAAGG - Intronic
1183923482 22:41188012-41188034 TTTTGTATTTATAGTGCAGACGG - Intergenic
1183938084 22:41275606-41275628 TTTTGTATTTTTAGTGAAGATGG - Intronic
1184129144 22:42507253-42507275 TTTTGTGTTTTTAGTGGAGATGG + Intergenic
1184139145 22:42567898-42567920 TTTTGTGTTTTTAGTGGAGATGG + Intronic
1184174805 22:42782359-42782381 TTTTGTATTTTTAGAGGAGATGG + Intergenic
1184222063 22:43107297-43107319 TTCTGTATTTTTAGTGGAGACGG - Intergenic
1184278300 22:43423005-43423027 TTTTGTGTTTTTAGTGGAGAGGG + Intronic
1184755063 22:46511195-46511217 TTTTGTTTTTACATAGAAGATGG + Intronic
1185252994 22:49815370-49815392 TTTTGTGTTTTTAGTGGAGATGG - Intronic
1185423124 22:50746260-50746282 TTCTGTGTTTTTAGTAGAGATGG - Intergenic
949524485 3:4889643-4889665 TTCTGTTTTGACAGAGGAGATGG + Intergenic
949645747 3:6091761-6091783 TTCTGTGTTTTTAGTAGAGACGG - Intergenic
949850328 3:8413987-8414009 TTTTGTGTTTTTAGTGGAGACGG - Intergenic
950071010 3:10152660-10152682 TTTTGTGTTTTTAGTGGAGACGG + Intergenic
950311976 3:11966778-11966800 TTTTGTGTTTTTAGTGGAGACGG + Intergenic
950382116 3:12625251-12625273 TTTTGTGTTTTTAGTGGAGATGG + Intronic
950690220 3:14650097-14650119 ATCTGTCTTTATGGAGAAAATGG - Intergenic
950700407 3:14741538-14741560 TTCTGTGTTTTCTGAGAAGGAGG + Intronic
950869404 3:16215737-16215759 TTCTGTATTTTTAGTGGAGACGG - Intronic
950871110 3:16229992-16230014 TGCTGAGTTCATAGAGAAGAAGG - Intronic
951154915 3:19339948-19339970 TTCTGTGTGTGGAAAGAAGAGGG + Intronic
951409237 3:22342101-22342123 TTCTGTGTTTTTAGTAGAGACGG - Intronic
951548320 3:23851629-23851651 TTTATTCTTTATAGAGAAGAGGG - Intronic
951596926 3:24328651-24328673 TCCAGTGTGAATAGAGAAGATGG - Intronic
951792847 3:26505249-26505271 TTCTGATTTTAAAGAGAAGCCGG + Intergenic
952304907 3:32137029-32137051 GTCTGTGATTATAGAGAAAGGGG + Intronic
952351418 3:32542576-32542598 TTTTGTATTTTTAGAAAAGACGG + Intronic
952377904 3:32782274-32782296 TTTTGTGTTTTTAGTGGAGACGG + Intergenic
952389288 3:32865995-32866017 TTTTGTGTATTTAGAGGAGATGG + Intronic
952648237 3:35688897-35688919 TTCTTTGTTTTAAGAGAAAAAGG + Intronic
952811627 3:37409463-37409485 TTTTGTGTTTTTAGTGGAGATGG + Intronic
952819341 3:37472564-37472586 TTTTGTGTTTTTAGTGGAGACGG + Intronic
953064690 3:39458142-39458164 TTTTGTGTTTATAGGAGAGATGG - Intergenic
953174084 3:40533309-40533331 TTCTGTATTTTTAGAAGAGATGG + Exonic
953313683 3:41906043-41906065 TTTTGTGTTTTTAGTGCAGACGG - Intronic
953750788 3:45606962-45606984 TTCTGTATTTTTAGTGGAGACGG + Intronic
953935886 3:47042189-47042211 TTTTGTGTTTTTAGTGGAGACGG - Intronic
953989258 3:47471538-47471560 TTTTGTATTTATAGTGGAGACGG + Intronic
954029251 3:47806615-47806637 TTTTGTATTTTTAGTGAAGATGG + Intronic
954086770 3:48250919-48250941 TTTTGTGTTTTTAGTGGAGACGG + Intronic
954257071 3:49414361-49414383 TTTTGTATTTTTAGTGAAGACGG - Intronic
954348818 3:50025250-50025272 TTTTGTATTTTTAGAAAAGACGG - Intronic
954552105 3:51490545-51490567 TTCTGTGTTCATGGATTAGAAGG + Intronic
954567679 3:51612292-51612314 TTCTGTTTTTTTAGTAAAGATGG - Intronic
954594345 3:51812573-51812595 TTCTGTGTTTTTAGTAGAGACGG - Intergenic
954813535 3:53262879-53262901 TTCTGTATTTTTAGTAAAGATGG + Intergenic
954823124 3:53348361-53348383 TTTTGTGTTTATAGTAGAGACGG + Intergenic
954896170 3:53976864-53976886 TTCTGTGTTTATATAGGATCTGG + Intergenic
955008332 3:54990587-54990609 CTCTGTCTTTCTGGAGAAGATGG - Intronic
955190594 3:56757892-56757914 TTTTGTATTTTTAGAAAAGACGG + Intronic
955285263 3:57634260-57634282 TTCTGTGTTTTTAGTAGAGACGG - Intronic
955372437 3:58364539-58364561 TTTTGTGTTTTTAGCGGAGATGG - Intronic
955668477 3:61376141-61376163 TTCTGTATTTTTAGTAAAGATGG - Intergenic
955676918 3:61458456-61458478 TTTTGTGTTTTTAGAAGAGACGG - Intergenic
955957220 3:64303311-64303333 TTTTGTGTTTTTAGTAAAGATGG - Intronic
956136332 3:66102770-66102792 TTTTGTGTTTTTAGTGGAGACGG + Intergenic
956307966 3:67847492-67847514 TTTTGTGTTTTTAGTGGAGACGG + Intergenic
956352438 3:68352566-68352588 ATCTGTCTGTATAGAAAAGAAGG + Intronic
956690808 3:71876238-71876260 TGTTGTTTTTATAGAGATGAGGG + Intergenic
956921701 3:73936843-73936865 CTTTGTCTTTATAGATAAGATGG + Intergenic
957210222 3:77249020-77249042 TTCTGTGTTTTTAGTAGAGAAGG + Intronic
957339829 3:78881375-78881397 TTCTCTGTTTACAGTGAAAATGG + Intronic
957510712 3:81184488-81184510 TTCTGTGTTTTTAGTAGAGACGG + Intergenic
957513694 3:81223736-81223758 TTCTGTGTATTCAGAGATGATGG + Intergenic
957573527 3:81980179-81980201 TTTTGTATTTTTAGAGGAGACGG + Intergenic
957743694 3:84308907-84308929 TTGTGTGTATATAGTAAAGATGG + Intergenic
957744728 3:84324850-84324872 TTTTGTGTTTTTAGTCAAGACGG - Intergenic
957799942 3:85064605-85064627 TATTTTGTTCATAGAGAAGAAGG + Intronic
957834790 3:85573361-85573383 TTTTGTATTTTTAGAGGAGACGG + Intronic
957898649 3:86457771-86457793 TTCTGTATTTATTGAACAGATGG + Intergenic
958806452 3:98816951-98816973 TTCTGTATTTTTAGTGGAGATGG + Intronic
958965233 3:100551183-100551205 TTCTGTATTTTTAGTGGAGACGG + Intronic
958971491 3:100615670-100615692 TTCTATGTTTGTAAACAAGAAGG - Intronic
959088855 3:101880944-101880966 TTTTTTGTTTGTAGAGAGGAGGG + Intergenic
959097499 3:101971734-101971756 TTTTGTATTTTTAGAGGAGATGG + Intergenic
959265559 3:104132954-104132976 TTCTGTGTCAGAAGAGAAGAAGG + Intergenic
959500472 3:107101094-107101116 TTCTGTGGCTAGAGAGTAGAGGG - Intergenic
960794323 3:121469013-121469035 TTTTGTGTTTTTAGTGGAGACGG - Intronic
960825737 3:121782200-121782222 TTCTATGTCTATAGAAAAAAGGG + Intronic
961579556 3:127868565-127868587 TTTTGTGTTTTTAGTAAAGATGG - Intergenic
961582622 3:127894992-127895014 TTTTGTGTTTTTAGTAAAGACGG + Intergenic
961587315 3:127943193-127943215 TTGTGTGTATACACAGAAGAGGG + Intronic
961728393 3:128948698-128948720 TTTTGTGTTTTTAGAAGAGATGG + Intronic
961758327 3:129145391-129145413 TTTTGTATTTTTAGAAAAGATGG + Intronic
962160028 3:132989341-132989363 TTTTGTATTTTTAGTGAAGATGG - Intergenic
962223260 3:133582320-133582342 TTTTGTGTTTTTAGTGGAGATGG + Intronic
962521791 3:136203931-136203953 TTTTGTATTTTTAGTGAAGACGG + Intergenic
962589808 3:136878236-136878258 TTGTGTGTTTATAGTTGAGATGG - Intronic
963171498 3:142256035-142256057 TTCTGTGTTTTTAGTACAGATGG - Intergenic
963721488 3:148866925-148866947 TTTTGTGTTTTTAGTGAAGACGG + Intronic
963880820 3:150526275-150526297 TTTTGTGTTTTTAGAAGAGATGG - Intergenic
963991188 3:151656596-151656618 TTGTGTGTTTATTCAAAAGATGG + Intergenic
964250088 3:154704435-154704457 ATCTTTGGTTAGAGAGAAGAAGG - Intergenic
964301331 3:155288777-155288799 TTTTGTGTTTTTAGAAGAGATGG + Intergenic
964357827 3:155866517-155866539 TTTTGTATTTTTAGTGAAGATGG - Intergenic
964369538 3:155985413-155985435 TTCTGTGTTTTTAGTGGAGACGG + Intergenic
964437275 3:156667399-156667421 CTCTGTTTTTATAGTAAAGAAGG - Intergenic
964518479 3:157538838-157538860 GTCTGTGTTTCTAGAAAGGAAGG + Intergenic
964608029 3:158579569-158579591 TTCTTTCTTTATATAGAAGTAGG - Intronic
965141145 3:164836299-164836321 TACATTGTTTATAGTGAAGATGG - Intergenic
965365355 3:167791952-167791974 TTCTGTATTTTTAGAAGAGATGG - Intronic
965504559 3:169498491-169498513 TTCAGTGTTTATACAGAAAAGGG + Intronic
965515980 3:169621584-169621606 TTTTGTGTTTTTAGTGGAGATGG - Intronic
965595722 3:170408880-170408902 TTTTGTATTTTTAGAGGAGACGG - Intergenic
965632695 3:170749536-170749558 TTGTGTGTTTAAAGAGATGATGG - Intronic
965978538 3:174657196-174657218 TTTTGTTTTTGTAGAGAGGAGGG + Intronic
966004661 3:174995418-174995440 TTTCCTGTTTATAGAGAAAAAGG - Intronic
966526119 3:180921195-180921217 TTTTGTGTTTTTAGTGGAGATGG - Intronic
967049392 3:185768854-185768876 TTCTGTATTTTTAGAAGAGATGG - Intronic
967358506 3:188601897-188601919 TTTTGTGTTTTTAGTAAAGATGG - Intronic
967696228 3:192534560-192534582 TTTTGTATTTTTAGAAAAGATGG + Intronic
967717377 3:192777717-192777739 TTTTGTGTTTTTAGAAGAGATGG + Intergenic
968061484 3:195729484-195729506 TTTTGTGTTTTTAGTAAAGACGG + Intronic
968207671 3:196818535-196818557 TTTTGTGTTTTTAGTAAAGACGG + Intronic
968426158 4:524826-524848 TTTTGTGTTTTTAGTGGAGATGG + Intronic
968440125 4:619215-619237 TTCTGTGTTTTTAGTAGAGACGG + Intergenic
968887538 4:3342664-3342686 TTCTGTGTTTACAGAGGTGGAGG + Intronic
969219522 4:5750817-5750839 GTCTATGTTTGTATAGAAGAGGG + Intronic
969378163 4:6776819-6776841 TACAGTGTTTATAGGGAAAACGG - Intergenic
969385043 4:6838956-6838978 TTCTGTATTTTTAGTGGAGATGG - Intronic
969474475 4:7413556-7413578 TTTTGTGTTTTTAGTGGAGATGG + Intronic
969558263 4:7928556-7928578 TTTTGTGTTTTTAGTAAAGATGG + Intronic
969910036 4:10435878-10435900 TTTTGTGTTTTTAGTGGAGACGG - Intergenic
970086464 4:12352887-12352909 TTTTGTGTTTTTAGTGGAGATGG - Intergenic
970115158 4:12686630-12686652 TTATTTGTTTGTAGAGATGAGGG - Intergenic
970405723 4:15761214-15761236 TTCTGTATTTTTAGTGGAGATGG + Intergenic
970540396 4:17072489-17072511 TTCTGTGCTCATGGGGAAGAAGG - Intergenic
970600388 4:17637197-17637219 TTTTGTATTTTTAGAGGAGACGG + Intronic
970783288 4:19766138-19766160 TTTTGTGTTTTTAGTGGAGATGG + Intergenic
970792166 4:19871108-19871130 GTGTGTGTGTATAGAAAAGAAGG - Intergenic
970936183 4:21572795-21572817 TTTTGTATTTTTAGTGAAGATGG + Intronic
971029465 4:22621050-22621072 TTTTGTGTTTTTAGTGGAGATGG - Intergenic
971132848 4:23832780-23832802 TTTTGTATTTTTAGTGAAGATGG + Intronic
971135631 4:23865011-23865033 TTTTGTGTTTTTAGTGGAGATGG - Intronic
971152883 4:24052464-24052486 TTTTGTGTTTTTAGTAAAGACGG - Intergenic
971199333 4:24497724-24497746 TTTTGTGTTTTTAGTAAAGATGG + Intergenic
971211050 4:24616633-24616655 TTTTGTGTTTTTAGCAAAGATGG + Intergenic
971337896 4:25740953-25740975 TTTTGTGTTTTTAGTGGAGATGG + Intergenic
971342210 4:25780994-25781016 TTCTGTATTTTTAGTGATGAGGG + Intronic
971344401 4:25798655-25798677 TTTTGTATTTTTAGGGAAGACGG - Intronic
971382208 4:26109274-26109296 TTCTGTATTTTTAGAAGAGATGG + Intergenic
971566072 4:28143349-28143371 TTTTGTGTTTTTAGTAAAGACGG - Intergenic
971622431 4:28872654-28872676 TTTTGTGTTTTTAGAAGAGACGG + Intergenic
971865835 4:32170625-32170647 TTTTGTGTTTTTAGTAAAGACGG + Intergenic
972048159 4:34694796-34694818 TTTTGTGTTTTTAGTGGAGATGG - Intergenic
972496542 4:39639608-39639630 TTTTGTGTTTTTAGTGGAGATGG - Intergenic
972620034 4:40738445-40738467 TTCTGTATTTTTAGTAAAGATGG + Intergenic
973077171 4:45943595-45943617 TTCTGTGTTTTTAGTAGAGATGG + Intergenic
973156134 4:46955118-46955140 TTCTGTGTTTATAAATAGCATGG - Intronic
973192261 4:47398960-47398982 TTCTGTATTTTTAGTGGAGACGG + Intronic
974442466 4:61937927-61937949 TTTTGTTTTAATAGAGAAGAGGG + Intronic
974876093 4:67704448-67704470 TTCTATGATTTTAGAGAAAAGGG + Intergenic
974926771 4:68309188-68309210 TTTTGTGTTTTTAGTAAAGATGG + Intergenic
974940824 4:68465658-68465680 TTCTGTGGTTTAAGTGAAGAGGG + Intronic
974976488 4:68900142-68900164 GTATTTGTTTATATAGAAGAGGG + Intergenic
975476855 4:74833500-74833522 TTTTGTGTTTTTAGTAAAGACGG - Intergenic
975766652 4:77675451-77675473 CTCTGTGATTATGGAGGAGATGG + Intergenic
976109674 4:81658107-81658129 TTTTGTGTTTTTAGAAGAGATGG + Intronic
976165819 4:82253720-82253742 TTTTGTGTTTTTAGTGGAGATGG + Intergenic
976244658 4:82995118-82995140 TTATTTTTTTGTAGAGAAGAAGG - Intronic
976569582 4:86593515-86593537 TTCAGTGTATATAGAAAAGTGGG + Intronic
976660622 4:87536615-87536637 TGCTGTGTTTTTAGTAAAGATGG + Intergenic
976799954 4:88978620-88978642 TTTTGTGTTTTTAGTAAAGACGG - Intronic
977107628 4:92908052-92908074 TACTGTGTTTTTAGATAATAAGG - Intronic
977319747 4:95498467-95498489 TTCAGTGTTTTTAGAAAAGATGG - Intronic
977588609 4:98802343-98802365 TTTTGTGTTTTTAGTGGAGATGG + Intergenic
977777184 4:100934989-100935011 TTCTTTTTTTGTAGAGAAAATGG - Intergenic
977848677 4:101797954-101797976 TTCAGTGTTGGTAGAGAAGGAGG + Intronic
978028221 4:103904856-103904878 GTAAGTGTTTATATAGAAGAAGG + Intergenic
978345890 4:107768763-107768785 TTTTGTGTTTTTAGTAAAGATGG - Intergenic
978604371 4:110463469-110463491 TTTTGTGTTTTTAGTAAAGATGG + Intronic
978607274 4:110494572-110494594 TTCTGTGTTTATTGATATAAAGG - Intronic
978812039 4:112860395-112860417 TTTTGTATTTTTAGTGAAGACGG + Intronic
979532163 4:121780352-121780374 TTATTTGTTTGTAGAGAAGGGGG - Intergenic
979892217 4:126112546-126112568 TTCTGTATTTTTAGTAAAGATGG + Intergenic
980341451 4:131553531-131553553 TTGTATGTTTATATAGTAGAAGG - Intergenic
980363477 4:131767772-131767794 TTTTGTGTTTTTAGTAAAGATGG + Intergenic
980535216 4:134111530-134111552 TTCTGTGTCTCTAGAGAACCAGG + Intergenic
980603847 4:135063456-135063478 TTCTTTCTTTATAGAGAATATGG + Intergenic
980949694 4:139362441-139362463 TTTTGTGTTTTTAGTGGAGACGG + Intronic
980994755 4:139769783-139769805 TTTTGTGTTTTTAGTAAAGATGG + Intronic
981002986 4:139845981-139846003 TTCTCTGTTTATATAGATGTTGG - Intronic
981115056 4:140980211-140980233 TTTTGTATTTTTAGGGAAGATGG + Intronic
981437012 4:144736304-144736326 TTTTGTATTTATAGTGGAGATGG + Intronic
981524608 4:145697268-145697290 TTTTGTGTTTTTAGAAGAGATGG + Intronic
981697312 4:147572278-147572300 TTTTGTGTTTTTAGAAGAGACGG + Intergenic
981987662 4:150877079-150877101 TTGTGTGTTTTTAGTAAAGACGG - Intronic
982004677 4:151052159-151052181 TTTTGTGTTTTTAGTGGAGACGG - Intergenic
982161019 4:152569486-152569508 TTCTGTGTTTTTAGTAGAGACGG - Intergenic
982220273 4:153118638-153118660 TTGTATTTTTTTAGAGAAGAGGG + Intergenic
982342489 4:154316610-154316632 TTTTGTGTTTTTAGAGGAGATGG - Intronic
982755915 4:159218583-159218605 TTTTGTGTTTTTAGTAAAGAAGG - Intronic
982913392 4:161174691-161174713 TTCTTTGTTTCTAGAGAATGAGG - Intergenic
983212313 4:164971419-164971441 TTCTGTGTTTTTAGTAGAGACGG - Intronic
983365857 4:166788009-166788031 TTTTGTATTTTTAGTGAAGACGG - Intronic
983563281 4:169122979-169123001 ATCTGGGTTTATAGATCAGAAGG - Intronic
983814334 4:172104114-172104136 TTTTGTGTTTTTAGTAAAGACGG + Intronic
984472412 4:180193360-180193382 TTTTGTGTTTTTAGCAAAGACGG + Intergenic
984636954 4:182121166-182121188 TTCTGTATTTTTAGTGGAGACGG + Intergenic
984882926 4:184426184-184426206 TTTTGTGTTTTTAGTGGAGATGG + Intronic
984930204 4:184840485-184840507 TTTTGTGTTTTTAGTGGAGACGG + Intergenic
985209113 4:187572872-187572894 TTTTGTATTTTTAGAGGAGACGG + Intergenic
985398807 4:189573211-189573233 TTTTGTGTTTTTAGGAAAGATGG - Intergenic
985667593 5:1189710-1189732 TTTTGTGTTTTTAGTAAAGATGG - Intergenic
986194427 5:5525108-5525130 TTTTGTGTTTTTAGTAAAGATGG + Intergenic
986952390 5:13105061-13105083 TTTTGTGTTTTTAGTAAAGATGG - Intergenic
987010869 5:13762737-13762759 TTCTTTGTTTATAGAAAAGAAGG + Exonic
987298994 5:16580338-16580360 TTCTGTCTTTGTGGATAAGATGG - Intronic
987549859 5:19365480-19365502 TGCTGTGTTTGTAGTGATGATGG - Intergenic
987581923 5:19805115-19805137 TTTTGTATTTATTGAGGAGATGG + Intronic
987670548 5:21001915-21001937 TTTTGTGTTTTTAGTGGAGACGG + Intergenic
987777154 5:22383000-22383022 TTTTGTGTTTTTAGTAAAGACGG + Intronic
987833771 5:23134439-23134461 TTTTGTGTTTTTAGTGGAGACGG - Intergenic
987912736 5:24170026-24170048 TTCTTTGATATTAGAGAAGAGGG + Intronic
988329825 5:29821362-29821384 TTTTGTATTTTTAGTGAAGATGG + Intergenic
988432006 5:31129952-31129974 TTCTGTATTTTTAGTGGAGATGG + Intergenic
988489375 5:31693410-31693432 TTCTGTATTTTTAGTAAAGACGG + Intronic
989150541 5:38294995-38295017 TTTTGTATTTTTAGTGAAGACGG + Intronic
989152988 5:38318673-38318695 TTTTGTGTTTTTAGTAAAGACGG + Intronic
989285166 5:39690993-39691015 TTTTGTATTTATAGTAAAGACGG + Intergenic
989595446 5:43152171-43152193 TTTTGTGTTTTTAGTGGAGACGG + Intronic
989637321 5:43549892-43549914 TTTTGTATTTTTAGAGGAGATGG + Intronic
989757567 5:44974629-44974651 TTTTGTATTTTTAGAGGAGATGG - Intergenic
989790667 5:45396389-45396411 TTTTTTTTTTATAGAGGAGATGG + Intronic
989977812 5:50607636-50607658 TTCTGTATTTTTGGAGGAGACGG + Intergenic
990417334 5:55598881-55598903 TTTTGTGTTTTTAGTAAAGACGG - Intergenic
990420781 5:55630959-55630981 TTTTGTGTTTTTAGTAAAGATGG - Intronic
990566143 5:57031417-57031439 TTGTGTGTTTTTAGAAGAGACGG + Intergenic
991067610 5:62440790-62440812 TTTTGTGTTTTTAGCAAAGACGG - Intronic
991356468 5:65774323-65774345 TTTTCTGCTTATAGAGTAGAAGG - Intronic
991361069 5:65820869-65820891 TTTTGTGTTTTTAGTAAAGATGG - Intronic
991365098 5:65859968-65859990 TTCTGTATTTTTAGTAAAGACGG - Intronic
991673175 5:69067789-69067811 TTCTGTATTTTTAGTAAAGACGG + Intergenic
991770209 5:70033828-70033850 TTTTGTGTTTTTAGAAGAGATGG + Intronic
991849504 5:70909247-70909269 TTTTGTGTTTTTAGAAGAGATGG + Intronic
991930241 5:71747117-71747139 TTTTGTGTTTATAGAGTTGGTGG + Intergenic
992254103 5:74904560-74904582 TTCTGTATTTTTAGTAAAGACGG + Intergenic
992429913 5:76700334-76700356 TTTTGTATTTTTAGAGGAGAAGG - Intronic
992524598 5:77596316-77596338 TTTTGTGTTTTTAGTGGAGACGG + Intronic
993652291 5:90536412-90536434 TTTTGTATTTTTAGAAAAGACGG - Intronic
993890802 5:93469476-93469498 TTCTGTGTATACAGAGAACCCGG + Intergenic
993989288 5:94636888-94636910 TTTTGTATTTTTAGTGAAGATGG + Intronic
994150889 5:96446405-96446427 TTCTGTGTTTGCAGAAAGGAGGG + Intergenic
994370244 5:98959299-98959321 TTCTTTTTTTAGAGAGATGAGGG - Intergenic
994371432 5:98971839-98971861 TTCTCTGCTGAGAGAGAAGAGGG - Intergenic
994536048 5:101030707-101030729 TTTTGTATTTATAGTGGAGATGG - Intergenic
994742957 5:103644005-103644027 TTCTGTGTTTTTAGTAGAGATGG - Intergenic
994770948 5:103981086-103981108 TTTTGTGTTTTTAGTGGAGATGG - Intergenic
994959281 5:106578227-106578249 TTTTGTGTTTTTAGTGGAGATGG + Intergenic
995333232 5:110968998-110969020 TTTTATGTTTTTAGAGAAGGTGG - Intergenic
995421347 5:111970653-111970675 TTCTGTGTTTTTAGTGGAGGCGG - Intronic
995972150 5:117985513-117985535 TTCTGTATTTTTAGTAAAGATGG + Intergenic
996652234 5:125892961-125892983 TTTTGTATTTTTAGTGAAGATGG - Intergenic
996816946 5:127584641-127584663 TTTTGTTTTTATAGAGACGGGGG + Intergenic
996869340 5:128169641-128169663 TTCTGTGTATATAGGGATTAGGG + Intronic
997255098 5:132422406-132422428 TTTTGTATTTTTAGAGGAGACGG + Intronic
997929122 5:138057891-138057913 TTCTGTATTTTTAGTGGAGATGG - Intergenic
997977873 5:138450814-138450836 TTTTGTATTTTTAGTGAAGACGG + Intergenic
998112494 5:139512985-139513007 ATCTGTGTTCATAAAGAGGAAGG - Intergenic
998297417 5:140985107-140985129 TTTTGTGTTTTTAGTAAAGACGG + Intronic
998633699 5:143929206-143929228 TTTTGTATTTTTAGAGGAGATGG - Intergenic
998665187 5:144288797-144288819 TTCTGTATTTTTAGTAAAGACGG - Intronic
999023501 5:148197758-148197780 TTCTGTATTTTTAGTAAAGATGG + Intergenic
999613026 5:153391356-153391378 TTTTGCCTTTATAGATAAGAGGG + Intergenic
999812518 5:155141106-155141128 TTCTGTGCTCACAGAGAACATGG - Intergenic
1000079968 5:157835711-157835733 TTGTGTGTTTGTTGAGTAGAGGG - Intronic
1000208058 5:159081152-159081174 TTCAGTTTTTATAGAGATGGGGG + Intronic
1000222222 5:159224960-159224982 TTTTGTATTTTTAGAAAAGAGGG + Intergenic
1000299454 5:159942636-159942658 TTGTGTGTTTGTAGAGATGAGGG - Intronic
1000597782 5:163235407-163235429 TTTTGTATTTTTAGAGGAGATGG + Intergenic
1000713018 5:164604357-164604379 TTCTGTATTTTTTTAGAAGAAGG + Intergenic
1000781868 5:165492356-165492378 TTTTGTGTTTTTAGTAAAGACGG + Intergenic
1000910663 5:167017997-167018019 TTTTGTGTTTTTATAAAAGATGG - Intergenic
1000981045 5:167817344-167817366 TTATTTGTTTATACAGAAAAGGG + Intronic
1001260407 5:170223600-170223622 TCCTGTTTTTGTAGAAAAGAAGG - Intergenic
1001341783 5:170853510-170853532 TTCTGTATTTTTAGTAAAGATGG - Intergenic
1001471798 5:172019252-172019274 TTTTGTGTTTTTAGTAAAGATGG + Intergenic
1001996328 5:176162398-176162420 ATCTGTGTTTCTAGGGCAGATGG + Intergenic
1002028152 5:176409583-176409605 TTCTGTATTTTTAGTAAAGACGG + Intronic
1002042722 5:176526531-176526553 TTCTGTGTTTTTAGTAGAGAAGG + Intergenic
1002118904 5:176986187-176986209 TTTTGTGTTTTTAGTGGAGATGG - Intronic
1002153403 5:177255409-177255431 CTCAGTGTTTATAGATAAAATGG + Intronic
1002202816 5:177540132-177540154 TTTTGTGTTTTTAGTGGAGACGG - Intronic
1002506052 5:179679827-179679849 TTTTGTATTTTTAGTGAAGACGG + Intronic
1002550592 5:179987705-179987727 TTCTGTGTCTATTGAGAATCTGG + Intronic
1002589410 5:180279126-180279148 TTCTGTATTTTTAGCAAAGACGG + Intronic
1002627561 5:180541622-180541644 TTTTGTATTTTTAGTGAAGACGG + Intronic
1002816450 6:685513-685535 GTCTGTGTTTATAGAGAACTGGG - Intronic
1002846401 6:949015-949037 TGTTCTGTTTATAGAAAAGAAGG + Intergenic
1002946835 6:1769895-1769917 TTTTGTATTTTTAGAGGAGATGG + Intronic
1003553391 6:7119178-7119200 TTTTGTGTTTTTAGTAAAGATGG - Intronic
1003692501 6:8368246-8368268 TTTTGTGTTTTTAGTCAAGACGG - Intergenic
1003860342 6:10317119-10317141 TTGTGTGTTTTTAGTGGAGACGG + Intergenic
1004045932 6:12022719-12022741 TCCTGTGTTTATAAAGCATATGG - Intronic
1004362812 6:14986194-14986216 TTTTGTGTTTTTAGTGGAGATGG + Intergenic
1004367421 6:15023752-15023774 TTCTGTATTTTTAGTAAAGACGG - Intergenic
1004466635 6:15891564-15891586 TTTTGTATTTTTAGTGAAGACGG - Intergenic
1004491413 6:16120406-16120428 TTTTGTGTTTTTAGTAAAGATGG + Intergenic
1004506030 6:16247543-16247565 TTTTGTATTTTTAGTGAAGATGG + Intronic
1004819421 6:19350781-19350803 TTATGTGTTTTTAGTGGAGATGG - Intergenic
1004884618 6:20039643-20039665 TTCTGTTTTTATAGAACACATGG - Intergenic
1004967816 6:20874671-20874693 TTCTGTATTTTTAGTGGAGATGG + Intronic
1005030463 6:21503866-21503888 CTCTGTTTTTCTAGAAAAGATGG + Intergenic
1005044040 6:21625026-21625048 TTTTGTGTTTTTAGTGCAGATGG - Intergenic
1005126224 6:22449774-22449796 TTTTGTATTTTTAGAAAAGATGG + Intergenic
1005148522 6:22721129-22721151 TTCTGTATTTTTAGTGGAGACGG - Intergenic
1005325730 6:24698806-24698828 TTTTGTGTTTTTAGTAAAGACGG + Intronic
1005343011 6:24860942-24860964 TTCCTTGTTTAGAGAGAATAAGG - Intronic
1005896375 6:30182526-30182548 TTTTGTGTTTTTAGAAGAGACGG - Intergenic
1006053785 6:31365285-31365307 TTTTGTGTTTTTGGTGAAGACGG - Intergenic
1006121262 6:31807411-31807433 TTTTGTATTTTTAGTGAAGATGG - Intergenic
1006177719 6:32132761-32132783 TTTTGTATTTTTAGTGAAGATGG + Intergenic
1006494056 6:34408676-34408698 TTCTGTATTTTTAGTAAAGACGG + Intronic
1006651692 6:35556945-35556967 TTATGTTTTTAAAGAGACGAGGG + Intergenic
1006721226 6:36153054-36153076 TTCTGTATTTTTAGTGCAGAGGG + Intergenic
1006728207 6:36215284-36215306 TTTTGTGTTTTTAGTGGAGATGG + Intronic
1006813963 6:36838739-36838761 TTCGTTGTTGATAGAGATGAAGG + Intronic
1006938978 6:37738819-37738841 TTTTGTGTTTTTAGTGGAGATGG - Intergenic
1007138497 6:39546653-39546675 TTTTGTGTTTTTAGAAGAGAAGG - Intronic
1007219509 6:40267397-40267419 TTCTGTTTTTATGTAGTAGAAGG - Intergenic
1007488731 6:42201105-42201127 TTTTGTGTTTTTAGTAAAGATGG + Intergenic
1007549030 6:42715036-42715058 TTTTGTATTTTTAGTGAAGATGG - Intronic
1007562743 6:42824063-42824085 TTCTGTGTTTTTAGTAGAGACGG - Intronic
1007819051 6:44547052-44547074 TTCTGTATTTATAGAGATAAGGG - Intergenic
1007877892 6:45127141-45127163 TTTTGTGTTTTTAGTGGAGACGG - Intronic
1008110079 6:47482548-47482570 TTTTGTGTTTTTAGTGGAGATGG + Intronic
1008639135 6:53443533-53443555 TTCTGTGTTTTTAGTAGAGATGG - Intergenic
1008738551 6:54577056-54577078 TTCTGTATTTTTAGTAAAGACGG + Intergenic
1008959567 6:57252609-57252631 TTTTGTGTTTTTAGTGGAGACGG + Intergenic
1008981541 6:57489382-57489404 TTTTGTGTTTTTAGTAAAGACGG - Intronic
1009169637 6:60382411-60382433 TTTTGTGTTTTTAGTAAAGACGG - Intergenic
1009409390 6:63348281-63348303 TTTTGTGTTTTTAGTAAAGACGG - Intergenic
1009973068 6:70645141-70645163 TTTTGTATTTTTAGAAAAGACGG - Intergenic
1010256509 6:73764642-73764664 TTTTGTGTTTTTAGTGGAGATGG - Intronic
1010349785 6:74859764-74859786 TTCTGTGTTTTTAGTAGAGATGG + Intergenic
1010726802 6:79344307-79344329 TTTTATGTTTATAGAGAACAGGG - Intergenic
1011006687 6:82653771-82653793 TTATGTTTTTATGCAGAAGAAGG - Intergenic
1011411920 6:87074987-87075009 TTTTGTATTTTTAGTGAAGACGG - Intergenic
1011420706 6:87169209-87169231 TTTTGTATTTTTAGTGAAGACGG + Intronic
1011421420 6:87177155-87177177 TTCTGTATTTTTAGTAAAGACGG - Intronic
1011601021 6:89060646-89060668 TTTTGTGTTTTTAGTGGAGATGG + Intergenic
1011889000 6:92133288-92133310 TTGTTTGCATATAGAGAAGATGG - Intergenic
1012164914 6:95937084-95937106 TTTTGTGTTTTTAGAAGAGATGG - Intergenic
1012264888 6:97129709-97129731 TTTTGTATTTTTAGTGAAGACGG - Intronic
1012275773 6:97273787-97273809 TTAAGTGTTTATAGGGAAAATGG - Intronic
1012352508 6:98270000-98270022 TTCTGTGTTTTTAGTAGAGATGG + Intergenic
1012470971 6:99571814-99571836 TTTTGTGTTTTTAGTGGAGACGG - Intergenic
1012611240 6:101223427-101223449 TTTTGTGTTTTTAGAAGAGATGG + Intergenic
1012854459 6:104485238-104485260 TTCGGTATTTAAAGAGAACAGGG - Intergenic
1012889540 6:104882919-104882941 TTCTGTGTTTTTAGTAGAGATGG + Intergenic
1013361994 6:109402363-109402385 TTTTGTGTTTTTAGTGGAGACGG - Intronic
1013570641 6:111420965-111420987 TTTTGTGTTTTTAGTGGAGAGGG - Intronic
1013786327 6:113785553-113785575 TTTTGTGTTTTTAGAAGAGACGG + Intergenic
1014150976 6:118054945-118054967 TTTTGTGTTTTTAGTGGAGACGG + Intronic
1014908975 6:127066125-127066147 TTTTGTATTTTTAGAGGAGATGG - Intergenic
1015157048 6:130108404-130108426 TTTTGTGTTTTTAGTGGAGACGG + Intronic
1015254085 6:131158675-131158697 TTTTGTATTTTTAGAGGAGATGG + Intronic
1015255914 6:131179342-131179364 TTTTGTGTTTATAGTAGAGACGG + Intronic
1015338859 6:132074597-132074619 TTCTGTGTTTTTTGTAAAGATGG + Intergenic
1015505455 6:133981499-133981521 TTCTGAGTTGATAGACAAGCTGG + Intronic
1015520758 6:134129028-134129050 TTCTGTATTTTTAGTAAAGACGG + Intergenic
1015556098 6:134462961-134462983 TTTTGTGTTTTTAGAAGAGATGG + Intergenic
1015592317 6:134833847-134833869 TTTTGTGTTTTTAGTGGAGACGG + Intergenic
1015767130 6:136730547-136730569 TTTTGTGTTTTTAGTGGAGACGG - Intronic
1016514936 6:144883319-144883341 TTATTTATTTATAGAGATGAGGG + Intergenic
1016835585 6:148473422-148473444 TTCTGTATTTTTAGTGGAGATGG + Intronic
1017257109 6:152346335-152346357 TTTTGTATTTTTAGTGAAGACGG + Intronic
1017347811 6:153405196-153405218 ATTTTTGTTAATAGAGAAGAAGG - Intergenic
1017478887 6:154829734-154829756 TTCTGTATTTTTAGTGGAGACGG - Intronic
1017507331 6:155080608-155080630 TTTTGTATTTATAGTGGAGACGG + Intronic
1017689151 6:156945835-156945857 TTTTGTATTTTTAGTGAAGATGG - Intronic
1017705036 6:157114350-157114372 TTTTGTGTTTTTAGTGGAGACGG - Intronic
1017765079 6:157600574-157600596 TTTTGTGTTTTTAGTAAAGATGG + Intronic
1017794895 6:157835181-157835203 TTCTGTATTTTTAGTGGAGATGG + Intronic
1018524661 6:164695407-164695429 TTTTGTGTTTATTGAGGACAGGG - Intergenic
1018795340 6:167180860-167180882 TTCTGTTCTTGTTGAGAAGATGG - Intronic
1018820981 6:167374202-167374224 TTCTGTTCTTGTTGAGAAGATGG + Intronic
1018900138 6:168047253-168047275 TTTTGTGTTTTTAGAAGAGACGG - Intergenic
1019281435 7:202393-202415 TCCTGTGTGCATAGAGAGGACGG + Intronic
1019939442 7:4277586-4277608 TTTTGTGTTTTTAGTAAAGACGG + Intergenic
1020121532 7:5506725-5506747 TTTTGTGTTTTTAGTAAAGACGG + Intronic
1020531184 7:9337823-9337845 TTTTGTGTTTTTAGTGGAGATGG - Intergenic
1020806044 7:12791421-12791443 TTCTGTGTTTTTAGTAGAGATGG - Intergenic
1020825830 7:13026890-13026912 TTTTGTGTTTATAGTAGAGATGG + Intergenic
1020828871 7:13067651-13067673 TTCTGGGTTTATAGATGAGGAGG - Intergenic
1021710688 7:23413028-23413050 TTCTGTATTTTTAGTTAAGATGG + Intronic
1021775504 7:24050792-24050814 TTTTGTGTTTTTAGTGGAGAGGG + Intergenic
1021896383 7:25239851-25239873 TTTTGTATTTTTAGTGAAGATGG + Intergenic
1022033670 7:26514857-26514879 CTCAGTGTTGCTAGAGAAGATGG + Intergenic
1022119672 7:27295787-27295809 GTGTGTGTTTAAAGAGAGGAAGG + Intergenic
1022266516 7:28760686-28760708 GTCTGTGTTTAGAGACAAGAAGG + Intronic
1022661694 7:32373815-32373837 TTCTGTATTTTTAGAAGAGATGG - Intergenic
1022677701 7:32515050-32515072 TACTGTGTCTATGGAGAAAAAGG - Intronic
1023006205 7:35870567-35870589 ATCTGTCTTTATAAAGGAGATGG + Intronic
1023047168 7:36220261-36220283 TTCTGATTTTATTGAGCAGATGG + Intronic
1024068124 7:45761154-45761176 ATCTGTCTTTATAAAGGAGAGGG - Intergenic
1024355682 7:48411476-48411498 TTTTGTGTTTTTAGTAAAGATGG + Intronic
1024728211 7:52224614-52224636 TTTTGTGTTTTTAGTAAAGACGG - Intergenic
1025009058 7:55381039-55381061 TTTTGTGTTTTTAGTGGAGATGG + Intronic
1025063733 7:55834815-55834837 TTTTGTGTTTTTAGTAAAGACGG + Intronic
1025216200 7:57058843-57058865 TTTTGTATTTTTAGTGAAGATGG - Intergenic
1025612913 7:63094013-63094035 TTCTGTATTTTTAGTGGAGACGG - Intergenic
1025655182 7:63511887-63511909 TTTTGTATTTTTAGTGAAGATGG + Intergenic
1026208268 7:68278769-68278791 TTTTGTATTTTTAGTGAAGACGG + Intergenic
1026303133 7:69116321-69116343 TTTTGTGTTTTTAGTGGAGATGG - Intergenic
1026542006 7:71287879-71287901 TTTTGTGTTTTTAGTGGAGATGG - Intronic
1026891882 7:73987129-73987151 TTTTGTATTTTTAGTGAAGACGG + Intergenic
1027003157 7:74668742-74668764 TTTTGTATTTTTAGAAAAGATGG + Intronic
1027255800 7:76430049-76430071 TTCTGTGTTTTTAGTAGAGATGG - Intronic
1027620862 7:80483303-80483325 TTCTGTGCTTATTGAAAAGCTGG + Intronic
1028465374 7:91145598-91145620 TTCTGTGTTAATGGAGGAAATGG + Intronic
1028479930 7:91293376-91293398 TTCTGTGTTTATACTGATGGTGG - Intergenic
1029040169 7:97565017-97565039 TTTTGTGTTTTTAGTGGAGACGG - Intergenic
1029262650 7:99313721-99313743 TTATGTGATTATAGAGGTGAAGG - Intergenic
1029347502 7:99989171-99989193 TTTTGTGTTTTCAGTGAAGACGG - Intergenic
1029533610 7:101142109-101142131 TTGTGTGTTTTTAGTGGAGACGG - Intergenic
1029557667 7:101281561-101281583 TTTTGTATTTTTAGTGAAGACGG - Intergenic
1029671574 7:102036135-102036157 TTTTGTGTTTTTAGTAAAGACGG + Intronic
1029727816 7:102419241-102419263 TTCTGTGTTTTTAGTAGAGATGG - Intronic
1030040077 7:105441555-105441577 TTTTGTATTTTTAGTGAAGACGG + Intronic
1030068035 7:105675450-105675472 TTCTGTGTTTTTAGTAGAGACGG - Intronic
1030138010 7:106276670-106276692 TTTTGTGTTTTTAGTGAAGACGG - Intronic
1030666131 7:112280796-112280818 TTTTGTGTTTGTAGTGGAGATGG + Intronic
1030727485 7:112942550-112942572 TTCTGTATTTATAGTAGAGACGG + Intergenic
1030785716 7:113658894-113658916 TTTTGTGTTTTTAGTAAAGATGG + Intergenic
1030815854 7:114036562-114036584 TTCTTTGTTTCTTGAGATGAGGG + Intronic
1031618869 7:123912353-123912375 TTTTGTGTTTAAAGAGATAAAGG - Intergenic
1031735273 7:125351500-125351522 GTCTTTATTTATAGAGAAGTTGG - Intergenic
1031842124 7:126756238-126756260 TTGTTTGTTTAAAGAGAATAAGG - Intronic
1032020186 7:128403385-128403407 TTTTGTGTTTTTAGTGGAGACGG - Intronic
1032173193 7:129602665-129602687 TTCTGTATTTATAGTAGAGATGG - Intergenic
1032438705 7:131924215-131924237 TTCTGTATTTTTAGTGGAGACGG + Intergenic
1032694700 7:134324963-134324985 TTCTGTATTTTTAGTGGAGACGG - Intergenic
1032738804 7:134718053-134718075 TTCTGTGTTTAAAAACAAAAGGG - Intergenic
1032827110 7:135581679-135581701 TTTTGTGTTTTTAGTGGAGATGG - Intronic
1032879319 7:136072282-136072304 TTTTGTGTTTTTAGAAGAGAGGG - Intergenic
1032977863 7:137246038-137246060 TACTGTGTTTATAGAGTCTATGG + Intronic
1033139487 7:138812659-138812681 TTTTGTATTTTTAGTGAAGACGG + Intronic
1033620554 7:143058483-143058505 TTCTGTGTCTGTGGAGGAGAGGG - Intergenic
1033817992 7:145098553-145098575 CTGTGTGTTTATAGGGAAGCTGG + Intergenic
1034005686 7:147469688-147469710 TTTTGTGTTTTTAGTGGAGACGG + Intronic
1034148886 7:148897751-148897773 TTTTGTGTTTTTAGTAAAGACGG - Intergenic
1034327451 7:150249623-150249645 TTCTGTGTTTTTAGTAGAGATGG + Intronic
1034408763 7:150925044-150925066 TTCTGTACTTTTAGGGAAGAAGG - Intergenic
1034698700 7:153077899-153077921 TTTTGTGTTTTTAGTGGAGATGG + Intergenic
1034765760 7:153719822-153719844 TTCTGTGTTTTTAGTAGAGATGG - Intergenic
1035029610 7:155848694-155848716 TTTTGTGTTTTTAGAAGAGATGG + Intergenic
1035251556 7:157600577-157600599 TTCTGTGTTTTTAGTAGAGATGG + Intronic
1035438929 7:158879720-158879742 TACTGGCTTTATAAAGAAGAAGG + Exonic
1035656395 8:1309922-1309944 TTTTGTGTTTTTAGTAAAGATGG - Intergenic
1035876075 8:3191052-3191074 CACTGTGTTTATAGTTAAGAGGG + Intronic
1035882438 8:3257149-3257171 TTTTGTGTTTTTAGCGGAGATGG - Intronic
1035883029 8:3263267-3263289 TTTTGTGTTTTTAGATAAAATGG + Intronic
1035988546 8:4461911-4461933 TTCTGTATTTTTAGAAGAGACGG + Intronic
1036512079 8:9409894-9409916 TTCTGTGTTTTTAGTAGAGATGG - Intergenic
1036599049 8:10242099-10242121 TTCTGTGTTTTTAGTAGAGATGG - Intronic
1036861358 8:12353710-12353732 TTTTGTGTTTTTAGTAAAGATGG + Intergenic
1036920304 8:12847472-12847494 TTTTGTATTTTTAGTGAAGACGG - Intergenic
1037468016 8:19179125-19179147 TTTTGTATTTTTAGTGAAGAGGG + Intergenic
1037476225 8:19260425-19260447 TTTTGTGTTTTTAGTGGAGATGG - Intergenic
1038277395 8:26133396-26133418 CTTTGTGTTTATACATAAGATGG + Intergenic
1038808453 8:30815373-30815395 TTCAGGGTTCCTAGAGAAGATGG + Intergenic
1038821802 8:30958882-30958904 TTTTGTATTTTTAGAAAAGACGG - Intergenic
1039128437 8:34231428-34231450 ATCTGTGTTTATATAAATGATGG - Intergenic
1039277571 8:35950699-35950721 TTCTGTGTTTTTAGTAGAGATGG + Intergenic
1039588067 8:38723522-38723544 TTTTGTTTTTATAGTGGAGATGG + Intergenic
1039797891 8:40931051-40931073 CTCTGTGTGTCTAGAGTAGAGGG - Intergenic
1039918843 8:41878890-41878912 TTTTGTGTTTTTAGTAAAGATGG - Intronic
1039932971 8:42011565-42011587 TTCTGTGTTTTTAGTAGAGACGG - Intronic
1040001362 8:42579226-42579248 TTCTATGCTTATAAAGAAAAAGG + Intergenic
1040807553 8:51410078-51410100 TTTTGTGCTTCTAGAGAACAAGG + Intronic
1041085737 8:54254768-54254790 TTTTGTGTTTTTAGTGGAGATGG - Intergenic
1041422153 8:57679600-57679622 GTATGTGTTTGTAGAGAAGATGG - Intergenic
1041536109 8:58927224-58927246 TTCTGATTTTTTAAAGAAGAGGG + Intronic
1041668558 8:60469321-60469343 TACTATGTTGATAAAGAAGAAGG + Intergenic
1041674377 8:60523327-60523349 TTTTGTATTTTTAGTGAAGACGG + Intronic
1041703621 8:60820137-60820159 ATACATGTTTATAGAGAAGATGG + Intronic
1041817256 8:61988276-61988298 TTTTGTATTTTTAGTGAAGACGG + Intergenic
1041821993 8:62046409-62046431 TTTTGTGTTTATGGATTAGAAGG - Intergenic
1041834555 8:62197086-62197108 TTCTGGGACGATAGAGAAGATGG - Intergenic
1042291238 8:67171226-67171248 TTCTGTATTTTTAGTAAAGATGG - Intronic
1042451861 8:68956814-68956836 TTTTGTATTTTTAGAAAAGATGG + Intergenic
1042563374 8:70090394-70090416 TTCTGTATTTTTAGTAAAGACGG + Intergenic
1042895170 8:73658740-73658762 TTTTGTATTTGTAGTGAAGACGG - Intronic
1042900694 8:73724232-73724254 TTTTGTTTTTTTGGAGAAGAGGG + Intronic
1042921778 8:73927225-73927247 TTTTGTGTTTTTAGTGGAGATGG - Intergenic
1042924357 8:73952231-73952253 TTTTGTGTTTTTAGTGGAGATGG - Intronic
1042926589 8:73973598-73973620 TTCTGTGTTTTTAGTGAAGACGG + Intronic
1043106094 8:76112192-76112214 TTCTGTGTTTGTAGATTAGAAGG + Intergenic
1043166884 8:76913979-76914001 TTCTGTTTTTATAAAGAATATGG - Intergenic
1043243520 8:77967935-77967957 TTAAGAGATTATAGAGAAGAAGG + Intergenic
1043446289 8:80322713-80322735 TTTTGTATTTTTAGTGAAGATGG + Intergenic
1043707470 8:83370168-83370190 TTCTGTGTTTTTAGTATAGATGG - Intergenic
1043727104 8:83624660-83624682 TTTTGTGTTTAGAGAAAGGAAGG + Intergenic
1043768488 8:84167227-84167249 TTCTGTATTTTTAGTAAAGACGG - Intergenic
1043937249 8:86155866-86155888 TTTTGTGTTTTTAGTGGAGACGG - Intergenic
1044077950 8:87846640-87846662 TTTTGTGTTTTTAGTGGAGATGG + Intergenic
1044084967 8:87933200-87933222 TTTTGTATTTTTAGTGAAGATGG + Intergenic
1044090061 8:87989419-87989441 TTCTGTGTTTTTAGTAGAGATGG + Intergenic
1044233645 8:89806631-89806653 TTTTGTGTTTTTAGTGGAGACGG + Intergenic
1044342874 8:91067857-91067879 TTCTTTTTTTAGAGACAAGAGGG - Intergenic
1044393967 8:91687496-91687518 CACTGTGTTTATAGATCAGAAGG + Intergenic
1044435979 8:92164806-92164828 TTTTGTATTTTTAGTGAAGACGG + Intergenic
1044677476 8:94743833-94743855 TTTTGTATTTTTAGAGGAGATGG - Intronic
1045366731 8:101483722-101483744 TTTTGTGTTTTTAGTAAAGACGG + Intergenic
1045579033 8:103458175-103458197 TTTTGTGTTTTTAGAAGAGATGG - Intergenic
1045784571 8:105905158-105905180 TTTTGTTATTATTGAGAAGAGGG - Intergenic
1045910403 8:107400728-107400750 TTCTGTATTTTTAGTAAAGACGG + Intronic
1045971684 8:108085409-108085431 TTCTTTGTGTAGAAAGAAGAGGG + Intergenic
1046200524 8:110921846-110921868 ATCTGAGTCTATAGGGAAGAAGG + Intergenic
1046287389 8:112111737-112111759 TTTTGTGTTTTTAGTAAAGATGG - Intergenic
1046488321 8:114915070-114915092 TTCTGTATTTATTGAGATAATGG + Intergenic
1046609126 8:116404560-116404582 TGCTGGGTCTATAAAGAAGATGG - Intergenic
1046627960 8:116595296-116595318 TTCTTTGTTTATAGAGATAGGGG - Intergenic
1046662974 8:116968905-116968927 TTTTGTGTTTTTAGTGGAGAGGG + Intronic
1046776468 8:118168877-118168899 TTCTTTCTTTATAGTGAAAATGG - Intergenic
1047084304 8:121499196-121499218 TTTTGTGTTTTTAGTGGAGATGG - Intergenic
1047091808 8:121583466-121583488 TTTTGTATTTTTAGTGAAGATGG - Intergenic
1047101915 8:121686199-121686221 TTTTGTGTTTTTAGTAAAGACGG + Intergenic
1047104202 8:121715489-121715511 TTCTTTATTTATACATAAGAGGG + Intergenic
1047326791 8:123846901-123846923 TTCTGTATTTTTAGAGAAGACGG - Intergenic
1047327427 8:123853323-123853345 TTCTGTATTTTTAGAGAAGACGG + Intronic
1047466982 8:125126211-125126233 TTCTGTATTTTTAGAAGAGATGG - Intronic
1047491360 8:125377263-125377285 TTCTGTGTTTTTAGTAGAGACGG + Intergenic
1047498505 8:125425629-125425651 TTTTGTATTTTTAGTGAAGACGG + Intergenic
1047738070 8:127784080-127784102 TTTTGTGTTTTTAGTGGAGATGG - Intergenic
1047738574 8:127788557-127788579 TTTTGTGTTTTTAGTGGAGACGG + Intergenic
1047796136 8:128257715-128257737 TTTTGTGTTTTTAGTGGAGATGG - Intergenic
1047857340 8:128925914-128925936 TTTTGTGTTTTTAGACGAGATGG + Intergenic
1048349299 8:133603259-133603281 TTTTGTGTTTTTAGTAAAGATGG + Intergenic
1048471281 8:134706519-134706541 TTCTGTATTTTTAGTGGAGACGG - Intronic
1048679787 8:136828177-136828199 TTCAGGGTGAATAGAGAAGATGG + Intergenic
1048680007 8:136831014-136831036 TTCTGACTTTTGAGAGAAGAAGG - Intergenic
1048930260 8:139309425-139309447 TTTTGTATTTTTAGTGAAGATGG + Intergenic
1048935572 8:139352984-139353006 TTTTGTGTTTTTAGTGGAGATGG - Intergenic
1049122156 8:140748321-140748343 TTCTGTATTTTTAGTAAAGATGG - Intronic
1049167963 8:141138554-141138576 TTTTGTGTTTTTAGTGGAGACGG + Intronic
1049821006 8:144633284-144633306 TTCTGTGTTTTTAGTAGAGACGG - Intergenic
1050079403 9:1900127-1900149 TTCTGTGTTTTTAGCAAAGACGG - Intergenic
1050574783 9:6982785-6982807 TTTTGGGTTGATAGAGAACATGG + Intronic
1051791904 9:20814525-20814547 TTCTGTGTTTTTAGTAGAGATGG + Intronic
1051815933 9:21105544-21105566 TTCTGTGTTTTTAATGAATAGGG - Intergenic
1051864125 9:21659849-21659871 TTGTGTGTTTAAATAGAAGTAGG - Intergenic
1052354018 9:27485744-27485766 TTCTGTGTTTATTGAGTTAAAGG + Intronic
1052435273 9:28419509-28419531 TTCTATGTTTAAGGACAAGATGG - Intronic
1052909084 9:33863991-33864013 TTTTGTGTTTTTAGTAAAGATGG + Intronic
1053205625 9:36183852-36183874 TTTTGTGTTTTTAGTAAAGACGG + Intergenic
1053235122 9:36446634-36446656 TTCTGTGTTTTTAGTAGAGACGG - Intronic
1053408778 9:37901336-37901358 TTCTGTATTTTTAGTGGAGACGG + Intronic
1053457943 9:38245626-38245648 TTTTGTGTTTTTAGAAGAGATGG + Intergenic
1053627635 9:39892070-39892092 TTTTGTGTTTTTAGTAAAGATGG + Intergenic
1053778359 9:41573953-41573975 TTTTGTGTTTTTAGTAAAGATGG - Intergenic
1054216252 9:62358632-62358654 TTTTGTGTTTTTAGTAAAGATGG - Intergenic
1054671229 9:67796711-67796733 TTTTGTGTTTTTAGTAAAGATGG + Intergenic
1054809066 9:69420520-69420542 TTATGTTTTTGTAGAGAAGGAGG + Intergenic
1055161827 9:73139243-73139265 TTCTGTGTTCTTAGAAATGATGG + Intergenic
1055370150 9:75589690-75589712 TTCTGTGATGATAGTGAAGAGGG + Intergenic
1055520064 9:77071740-77071762 TTCTGTATTTTTAGTAAAGATGG + Intergenic
1056607041 9:88094474-88094496 TTTTGTATTTTTAGTGAAGATGG + Intergenic
1057115636 9:92518716-92518738 TTTTGTATTTTTAGAGGAGATGG - Intronic
1057166317 9:92929617-92929639 TTTTGTATTTTTAGAAAAGATGG + Intergenic
1057536010 9:95907373-95907395 TTTTGTGTTTTTAGTAAAGACGG + Intronic
1057896098 9:98909849-98909871 TTGTTTGTTTGTAGAGAAGGAGG - Intergenic
1057967556 9:99518940-99518962 TTTTGTGTTTTTAGTGGAGATGG - Intergenic
1058009469 9:99960612-99960634 TTTTGTATTTTTAGTGAAGACGG + Intronic
1058083798 9:100727257-100727279 TTTTGTATTTTTAGAAAAGATGG - Intergenic
1058524966 9:105848598-105848620 TTCTGTATTTTTAGTAAAGACGG - Intergenic
1058680857 9:107439063-107439085 TTTTGTGTTTTTAGTAAAGACGG - Intergenic
1058848634 9:108988252-108988274 TTCTGTATTTTTAGAAGAGATGG + Intronic
1059116588 9:111605153-111605175 TTTTGTGTTTATAGAAGAGATGG - Intergenic
1059172736 9:112141504-112141526 TTTTGTGTTTTTAGTAAAGATGG - Intronic
1059372082 9:113849956-113849978 TTTTGTATTTTTAGTGAAGACGG + Intergenic
1059690326 9:116678653-116678675 TTCTGTGGGTATAAACAAGATGG + Intronic
1059873172 9:118601166-118601188 TTATGTTTTTATAGAGGAAAGGG - Intergenic
1060039649 9:120288880-120288902 TTTTGTGTTTTTAGTGTAGATGG - Intergenic
1060273089 9:122161234-122161256 TTCTGAGTTAATAGGAAAGAGGG + Intronic
1060511332 9:124235722-124235744 AACTGTGTTTGTAGAGAACATGG + Intergenic
1060634219 9:125187452-125187474 TTCTGTGTTTTTAGTAGAGAGGG + Intronic
1060834535 9:126745173-126745195 TTTTGTGTTTTTAGTGGAGACGG - Intergenic
1060857332 9:126925374-126925396 TTTTGTATTTTTAGTGAAGAGGG - Intronic
1060951447 9:127606417-127606439 TTTTGTATTTTTAGTGAAGATGG + Intergenic
1061439024 9:130586919-130586941 TTTTGTATTTTTAGTGAAGACGG + Intronic
1061456927 9:130705345-130705367 TTCTGTATTTTTAGTGGAGACGG - Intergenic
1061468337 9:130801396-130801418 TTCTGTGTTTTTAGTAGAGACGG + Intronic
1061671743 9:132192642-132192664 TACTGTGTTTGTAGAGGAAAAGG + Intronic
1061688054 9:132299956-132299978 TTTTGTGTTTTTAGTGGAGACGG - Intronic
1062314252 9:135958217-135958239 TTCTGTATTTTTAGTAAAGATGG + Intronic
1185534154 X:846328-846350 TTCTGTGTTTTTAGTAGAGACGG + Intergenic
1185646955 X:1622739-1622761 TTTTGTGTTTTTAGTAAAGATGG - Intronic
1185864760 X:3613672-3613694 TTGTGTGTTTTTAGAAGAGATGG - Intronic
1186222127 X:7360825-7360847 TTCTGTGGTTATAGTGTAAAAGG - Intergenic
1186286966 X:8055375-8055397 TTCTTTATTTTTACAGAAGAGGG - Intergenic
1186374654 X:8986452-8986474 TTCTGTTTTTAAAGAGGAAAAGG - Intergenic
1186534752 X:10335071-10335093 TTTTGTATTTTTAGTGAAGACGG - Intergenic
1187245137 X:17547130-17547152 TTCTGTGTGAGTGGAGAAGAAGG + Intronic
1187327654 X:18306839-18306861 TTTTATTTTTATAGAGATGAGGG + Intronic
1187550049 X:20293391-20293413 TTTTGTGTTTTTAGTGGAGACGG + Intergenic
1187625133 X:21103026-21103048 TCCTGTGTGTATAGAGAGTATGG + Intergenic
1187936634 X:24342604-24342626 TTTTGTGTTTTTAGTGGAGATGG - Intergenic
1188292375 X:28405484-28405506 TTTTGTATTTTTAGTGAAGATGG + Intergenic
1188706715 X:33342791-33342813 TTCTGTGTTCATGGACTAGAAGG - Intergenic
1188742972 X:33809093-33809115 TTCTGTTTTTCTCAAGAAGAAGG + Intergenic
1189453704 X:41164041-41164063 TTTTGTGTTTTTAGAAGAGACGG + Intronic
1189512929 X:41681772-41681794 TTTTGTGTTTTTAGTAAAGATGG - Intronic
1189624734 X:42884321-42884343 TTCAGTGTTTAGTGAGAATATGG + Intergenic
1189742070 X:44129340-44129362 TTCTGTATTTTTAGAAGAGATGG - Intergenic
1189799250 X:44676609-44676631 TTCTGTATTTTTAGTGGAGATGG - Intergenic
1189949401 X:46213418-46213440 TTTTGTGTTTTTAGTGGAGATGG - Intergenic
1190081926 X:47363408-47363430 TTTTGTGTTTCTAAAGAAAAAGG - Intergenic
1190497314 X:51039339-51039361 TCCAGGGTTTATAGTGAAGATGG - Intergenic
1191130920 X:57009643-57009665 TTCTGTGTTTTTAGTAGAGATGG + Intergenic
1191939337 X:66461313-66461335 TTTTGTATTTTTAGAAAAGACGG - Intergenic
1192187784 X:68964543-68964565 TTTTGTGTTTTTAGTAAAGATGG + Intergenic
1192235487 X:69292847-69292869 TTCTGTATTTTTAGTAAAGACGG - Intergenic
1192257672 X:69478088-69478110 TTCTGTGTTCATGGATTAGAAGG + Intergenic
1192415386 X:70975207-70975229 TTTTGTGTTTTTAGTGGAGACGG - Intergenic
1192475561 X:71438790-71438812 TTTTGTATTTTTAGTGAAGACGG - Intronic
1193110431 X:77724106-77724128 TTTTGTGTTTCTAGGGGAGACGG - Intronic
1193796766 X:85886998-85887020 TTCTCTTTTTATTGAGAACAAGG + Intronic
1194318216 X:92408752-92408774 TTTTGTGTTTTTAGTAAAGACGG + Intronic
1194342575 X:92722711-92722733 TTCTGTGGTTTTTGTGAAGAGGG + Intergenic
1194721074 X:97340824-97340846 TTTTGTATTTTTAGAAAAGATGG + Intronic
1194875131 X:99177863-99177885 TTCTTTGTTTATCCATAAGAAGG + Intergenic
1195801724 X:108719374-108719396 TTTTGTGTTTTTAGTAAAGACGG - Intergenic
1196188511 X:112770900-112770922 TTTTGTGTTTTTAGTGGAGATGG - Intergenic
1196430612 X:115620862-115620884 TTTTGTATTTTTAGTGAAGACGG + Intronic
1196536920 X:116856951-116856973 TTTTGTGTTTTTAGTAAAGATGG - Intergenic
1196610408 X:117707907-117707929 TTTTGTATTTTTAGTGAAGATGG + Intergenic
1196631836 X:117950294-117950316 TTTTGTGTTTTTAGTGGAGACGG - Intronic
1197065895 X:122233813-122233835 TTCTGTATTTTTAGAAGAGACGG - Intergenic
1197433563 X:126397089-126397111 TTCAGTGTTTGTTGAGTAGAAGG + Intergenic
1198737414 X:139802057-139802079 TTCTGGGTTGATAGTGAACAAGG + Intronic
1199368533 X:147017951-147017973 TTTTGTGTTTTTAGTGGAGACGG + Intergenic
1199788746 X:151130052-151130074 TTCTATGTTTATCCAAAAGACGG + Intergenic
1200032642 X:153308909-153308931 TTCTTTGTTTTTATACAAGAGGG + Intergenic
1200319842 X:155176336-155176358 TTTTGTATTTTTAGTGAAGATGG + Intergenic
1200650939 Y:5839396-5839418 TTCTGTGGTTTTTGTGAAGAGGG + Intergenic
1201165693 Y:11206511-11206533 TTTTGTGTTTTTAGAAGAGACGG - Intergenic
1201785716 Y:17775877-17775899 TTTTGTGTTTTTAGTGTAGATGG - Intergenic
1201815837 Y:18130111-18130133 TTTTGTGTTTTTAGTGTAGATGG + Intergenic
1202084526 Y:21122217-21122239 TTTTGTATTTTTAGTGAAGATGG - Intergenic
1202172332 Y:22063826-22063848 TTGTGTGTTTTTAGTAAAGATGG - Intergenic
1202219032 Y:22522545-22522567 TTGTGTGTTTTTAGTAAAGATGG + Intergenic
1202301098 Y:23415241-23415263 TTCTGTATTTTTAGTAAAGATGG + Intergenic
1202324151 Y:23673507-23673529 TTGTGTGTTTTTAGTAAAGATGG - Intergenic
1202339320 Y:23844676-23844698 TTCTGTGTTTTTAGTAGAGACGG + Intergenic
1202531446 Y:25825392-25825414 TTCTGTGTTTTTAGTAGAGACGG - Intergenic
1202546620 Y:25996547-25996569 TTGTGTGTTTTTAGTAAAGATGG + Intergenic
1202569713 Y:26255357-26255379 TTCTGTATTTTTAGTAAAGATGG - Intergenic