ID: 1174905568

View in Genome Browser
Species Human (GRCh38)
Location 20:54546868-54546890
Sequence CAGGGAGACCAGACATTTGG TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 221
Summary {0: 1, 1: 0, 2: 0, 3: 21, 4: 199}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1174905564_1174905568 -10 Left 1174905564 20:54546855-54546877 CCCCAATGGTGGACAGGGAGACC 0: 1
1: 0
2: 2
3: 8
4: 106
Right 1174905568 20:54546868-54546890 CAGGGAGACCAGACATTTGGTGG 0: 1
1: 0
2: 0
3: 21
4: 199
1174905559_1174905568 12 Left 1174905559 20:54546833-54546855 CCTTAATTGTAGAACAGTGATTC 0: 1
1: 0
2: 0
3: 11
4: 149
Right 1174905568 20:54546868-54546890 CAGGGAGACCAGACATTTGGTGG 0: 1
1: 0
2: 0
3: 21
4: 199
1174905558_1174905568 15 Left 1174905558 20:54546830-54546852 CCACCTTAATTGTAGAACAGTGA 0: 1
1: 0
2: 1
3: 11
4: 132
Right 1174905568 20:54546868-54546890 CAGGGAGACCAGACATTTGGTGG 0: 1
1: 0
2: 0
3: 21
4: 199

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1174905568 Original CRISPR CAGGGAGACCAGACATTTGG TGG Intronic
900940454 1:5795321-5795343 CAGGCTGACCAGATATTTGCGGG - Intergenic
901779242 1:11582096-11582118 CTGGGGGCACAGACATTTGGAGG + Intergenic
902208238 1:14885451-14885473 CAGGCAGACCTGACATATGTTGG - Intronic
902465336 1:16613792-16613814 CGGGGAAACCAGCGATTTGGAGG - Intergenic
903328198 1:22583259-22583281 CAGGGAGCCCAGAGACCTGGAGG - Intronic
904410574 1:30322443-30322465 CAAGGAGCCCAGTCAATTGGAGG - Intergenic
904573450 1:31485201-31485223 CAGCTATACAAGACATTTGGAGG - Intergenic
906195418 1:43927607-43927629 CAGGGAAAACAGAGACTTGGAGG - Intronic
906280629 1:44550885-44550907 CTAGGAGACCAGACACATGGGGG - Intronic
907522746 1:55035057-55035079 TAGGAAGCCCAGACATGTGGTGG - Intergenic
908246889 1:62234436-62234458 AAGGGAAAGCAGGCATTTGGGGG - Intergenic
908692514 1:66798391-66798413 CAGAGAGATTAGACATTTTGGGG + Intronic
910220793 1:84887904-84887926 CAGGTAGAAGAGACATTTGGGGG + Intronic
911581957 1:99644501-99644523 TAGGGAGACCAGAGAATGGGAGG - Intergenic
913347665 1:117824731-117824753 CAGGGAAGCCAGGGATTTGGTGG + Intergenic
914940300 1:152017004-152017026 CTGGGAGACCTGACATTCTGTGG - Intergenic
916217715 1:162411690-162411712 CAGGGAGAGCAGGCAGATGGAGG + Intronic
917613315 1:176711874-176711896 CAGGGAAACCAGCCAGTTAGGGG - Exonic
922340332 1:224649748-224649770 CAGGCAGACCCTGCATTTGGTGG - Intronic
924082363 1:240412694-240412716 CTGGAAGACCAGACATAGGGAGG + Intronic
1062977714 10:1697812-1697834 CAGGGAGTCGGGGCATTTGGGGG - Intronic
1063073859 10:2694965-2694987 GAGGGAGAAAGGACATTTGGGGG + Intergenic
1063462775 10:6225050-6225072 GGGGGAGGCCTGACATTTGGAGG + Intronic
1064418862 10:15173149-15173171 CAGGGAGACATGGCATCTGGAGG - Intergenic
1065484261 10:26221884-26221906 CAGGGACACCTGACCTATGGGGG + Intronic
1067966688 10:50921429-50921451 CAGGGAGCCCAGGCATTTTTAGG + Intergenic
1068140856 10:53005193-53005215 CTGGGAGATCAGACATCTGGGGG + Intergenic
1068253558 10:54476623-54476645 AAGGGTGATCAGAAATTTGGAGG + Intronic
1068770670 10:60817484-60817506 CGGGGAGACCATCCAATTGGTGG - Intergenic
1068958323 10:62841567-62841589 CTGGGAGACCAGAAGTTTGGGGG - Intronic
1072493048 10:95927846-95927868 CAGGGAGACTACACAGTTTGAGG - Intronic
1072713768 10:97735916-97735938 CAGGTAGCCCAGAAATATGGAGG + Intergenic
1073036063 10:100564997-100565019 CAGAGAGAGCAGACACTTGAAGG + Intergenic
1075979504 10:126724615-126724637 CAGGGACTCCAGAGGTTTGGGGG + Intergenic
1077357098 11:2123438-2123460 CAGGGAGGCCAGACTCCTGGGGG + Intergenic
1080653319 11:34239767-34239789 CAGGGAACACTGACATTTGGGGG + Intronic
1081708303 11:45199657-45199679 CTGGGAGACCAGTCTTCTGGGGG + Intronic
1084753991 11:71223055-71223077 GAGGGAGCTCAGAGATTTGGAGG + Intronic
1087582159 11:100071017-100071039 TAAGTAGACAAGACATTTGGAGG + Intronic
1089310562 11:117555655-117555677 CAGGGAGAGCAGGGGTTTGGCGG + Intronic
1089873318 11:121696034-121696056 CAGGGAAACAAGGCATTGGGAGG - Intergenic
1091296969 11:134480729-134480751 CAGAGAGAACAGACAGATGGGGG + Intergenic
1094487713 12:30938281-30938303 GAGGGTGGACAGACATTTGGGGG - Intronic
1096480492 12:51937549-51937571 CAGAGATCCCAGGCATTTGGGGG + Intergenic
1096701055 12:53383058-53383080 CAGCAAAACCAGACATCTGGAGG + Exonic
1099642580 12:85311266-85311288 CAGGCACACCAGATATTAGGAGG + Intergenic
1100678203 12:96891274-96891296 CAGGGAATACAGACATTTAGAGG + Intergenic
1102644726 12:114396539-114396561 CAGGGATGCCAGGAATTTGGTGG + Intronic
1103576475 12:121881308-121881330 CAGGGAGGGAAGAGATTTGGAGG - Intergenic
1104609846 12:130219168-130219190 CAGAAAGACCATAGATTTGGTGG + Intergenic
1105370293 13:19796168-19796190 CAGGGTGACCAGACCCCTGGGGG + Intergenic
1106062866 13:26311932-26311954 CAGGAAGAATAGACATTGGGTGG + Intronic
1107423628 13:40272392-40272414 CAGGGACACAAGACATTGGGTGG - Intergenic
1108467115 13:50727603-50727625 CAGGGAGCCCAGGCCTTAGGGGG - Intronic
1114113578 14:19498015-19498037 CAGAGAGACAAGAAAGTTGGGGG - Intergenic
1116752654 14:48906035-48906057 CAGGGAGACCATGCATGTGGAGG + Intergenic
1117589429 14:57251289-57251311 CAGGGATCTCAGATATTTGGAGG - Intronic
1118839011 14:69497275-69497297 CAGAGAGACCTGACATTTTCCGG - Intronic
1119553544 14:75535730-75535752 TAGGGTGACCAGACATTTACTGG - Intronic
1120792662 14:88599474-88599496 CATGGAGACCAGACAGACGGGGG - Intronic
1121320469 14:92988925-92988947 CAGAGAGGCCACACAATTGGCGG + Intronic
1121499392 14:94421571-94421593 CAGGGAGACAGGAAATCTGGAGG - Intergenic
1122595757 14:102889906-102889928 CAGGTAGACTTGACATTTGGTGG + Intronic
1123739272 15:23219536-23219558 CAGGGAGACCACACAACTGGAGG + Intergenic
1124290491 15:28448492-28448514 CAGGGAGACCACACAACTGGAGG + Intergenic
1124292746 15:28469056-28469078 CAGGGAGACCACACAACTGGAGG - Intergenic
1124701254 15:31914439-31914461 CAAGGAGACCAGTCACCTGGGGG + Intergenic
1125121218 15:36160937-36160959 CAGGGAGACTAGAAATTTTGTGG + Intergenic
1126358154 15:47818007-47818029 CAGGGAGATGCGACATTTGGGGG - Intergenic
1128328773 15:66742300-66742322 GAGGGAAACCAGACATTGGTGGG - Intronic
1129323702 15:74788681-74788703 TGGGGAGACCAGAAATCTGGGGG + Intronic
1130392768 15:83473526-83473548 TAGAGAGAGCAGACATTTGTTGG + Intronic
1130602511 15:85285983-85286005 CATGGAGGCCAGAAAGTTGGAGG + Intergenic
1130766377 15:86875668-86875690 CATGGAGGCCAGAAAGTTGGAGG - Intronic
1132574970 16:660062-660084 CAGGGACACCAGGAATTCGGGGG + Exonic
1132617903 16:851481-851503 CAGGGACCCCAGACGTTTGGGGG + Intergenic
1133207237 16:4240990-4241012 CAGGGAGAGCAGGCAGTGGGTGG - Intronic
1134202510 16:12210618-12210640 CAGGGGGACCAGAAAGGTGGTGG - Intronic
1135164573 16:20127446-20127468 CAGGGAGGCCAAACAATTGAAGG + Intergenic
1135674546 16:24404325-24404347 CAAGGAGACAAAAGATTTGGGGG + Intergenic
1135783955 16:25331275-25331297 CAGAGAGGGCAGACATTAGGTGG + Intergenic
1137903939 16:52300150-52300172 CAGGGACACCTGATATTTCGTGG - Intergenic
1139411473 16:66764748-66764770 CTGGGAGACCAGACAAATAGTGG + Intronic
1142048596 16:87942766-87942788 CATGGTGCCCAGATATTTGGTGG + Intergenic
1143180260 17:4980147-4980169 CAGAGGGGCCAGACATATGGAGG - Exonic
1144052975 17:11513885-11513907 CAGGCAGACCAGACAATTGCGGG + Intronic
1144222746 17:13114771-13114793 CACGGAGACCACACACATGGCGG + Intergenic
1144326019 17:14181055-14181077 CATGGAGACCAACCATGTGGAGG + Intronic
1144474892 17:15577943-15577965 CATGGAGACCAACCATGTGGAGG + Intronic
1144689654 17:17252310-17252332 CTGGCAGTCCTGACATTTGGGGG + Intronic
1147113938 17:38284689-38284711 TAGGGAGAGCACAAATTTGGAGG + Intergenic
1147250441 17:39150138-39150160 CAGGGAGACCACACAGAGGGTGG - Intronic
1147551956 17:41449459-41449481 CAGGTGGGCAAGACATTTGGTGG - Intergenic
1148091785 17:45026802-45026824 CAGGGAGACCACATATCTGTGGG + Intronic
1148415668 17:47504502-47504524 TAGGGAGAGCACAAATTTGGAGG - Intergenic
1152863017 17:82706675-82706697 GACGGAGAGCTGACATTTGGTGG - Intergenic
1153540409 18:6147996-6148018 CAGGGAGATCAGAGGTTTGATGG + Intronic
1153784600 18:8523401-8523423 CAGGGGGATCAGAGATGTGGAGG + Intergenic
1155062669 18:22242521-22242543 CAGGAAGAGCAGGCTTTTGGAGG - Intergenic
1156508220 18:37612640-37612662 CAGGGAGAGCAGAGACTTGCTGG + Intergenic
1160526893 18:79543622-79543644 CAGGGAGACCAGGCCTGGGGAGG + Intergenic
1161506725 19:4648241-4648263 CAGGGTGCCCTGGCATTTGGAGG + Intronic
1162743138 19:12784202-12784224 CAGGGTGACCAGACAGGGGGCGG + Intronic
1162953439 19:14085406-14085428 CCGGGGGACCAGAGGTTTGGGGG + Exonic
1164960897 19:32428577-32428599 CAGAGTGACCAGACATTATGTGG + Intronic
1166068571 19:40374681-40374703 CATGGAGACCAGAAAGCTGGTGG + Intronic
1166487828 19:43228891-43228913 CAAGGAGAGAAAACATTTGGGGG - Intronic
929483592 2:42335962-42335984 CAGGAAGAACAGGCATTTGCTGG - Intronic
930444655 2:51454988-51455010 CAGGAAGAAAAGACATCTGGGGG - Intergenic
931588813 2:63858143-63858165 CAGGGAGATCAGACTGTTAGAGG - Intronic
932096106 2:68850303-68850325 CTGGCACACCAGAAATTTGGAGG - Intergenic
932593971 2:73082963-73082985 CTGGGAGACCAGCCATGAGGAGG - Intronic
934673846 2:96235359-96235381 CAGGGAGCACACTCATTTGGTGG - Intergenic
936915390 2:117634699-117634721 GAGGGCAACCAGCCATTTGGTGG - Intergenic
941037058 2:160580235-160580257 CAATTAAACCAGACATTTGGAGG - Intergenic
942122614 2:172793158-172793180 CCGGGAAAACAGCCATTTGGAGG - Intronic
942599022 2:177621136-177621158 TAGGGATCCCAGAAATTTGGAGG - Intergenic
944376459 2:199049809-199049831 CAGGGATACCAGAGACTTGTGGG + Intergenic
945544609 2:211136087-211136109 AAGGGAGATCAGACATTTCCAGG - Intergenic
946171324 2:217897716-217897738 CAGGGATACCAGTCATGTAGAGG + Intronic
949069489 2:242015670-242015692 CAGGGAGAGAGGACATTTGAGGG - Intergenic
1170073297 20:12392030-12392052 CATGGAGACAAAAGATTTGGAGG + Intergenic
1170414080 20:16121578-16121600 GATGGAGAGAAGACATTTGGAGG - Intergenic
1170793533 20:19527074-19527096 CAGGGAGACCAAAGGTTTTGGGG - Intronic
1171166788 20:22979087-22979109 CAGAGAGAGCAGGCTTTTGGGGG + Intergenic
1172202821 20:33138922-33138944 CAAGGAAACAAGTCATTTGGAGG + Intergenic
1174904520 20:54536628-54536650 CAGGGAGAGCAGGCTTTTGCTGG - Intronic
1174905568 20:54546868-54546890 CAGGGAGACCAGACATTTGGTGG + Intronic
1175178639 20:57129255-57129277 CAAGAAGACCAGAAATCTGGTGG - Intergenic
1175507249 20:59494668-59494690 CAGGGACACCAGGCCTTTGGAGG + Intergenic
1175735811 20:61386281-61386303 CAGGGAGGCCATGCCTTTGGAGG - Intronic
1176381117 21:6112288-6112310 CGGGGCGACCCGACCTTTGGCGG + Intronic
1177801215 21:25830781-25830803 CAGGGAGACAAGAAAGTAGGAGG + Intergenic
1178387326 21:32163535-32163557 CAGGCAGAGCAGTCATTTTGCGG - Intergenic
1179242127 21:39601887-39601909 GAGGGAGACCAGGCATGGGGTGG + Intronic
1179581650 21:42348098-42348120 CAGGGAAACCAGGCAGATGGTGG - Intronic
1179678478 21:43001049-43001071 GAGGGAAAGCAGAGATTTGGAGG + Intronic
1179742355 21:43425952-43425974 CGGGGCGACCCGACCTTTGGCGG - Intronic
1181114829 22:20625281-20625303 GAGGTAGACAAGGCATTTGGAGG - Intergenic
1182710369 22:32318903-32318925 CAGGGTGCCCTGATATTTGGTGG + Intergenic
1183375507 22:37462525-37462547 TGGAGAGAACAGACATTTGGTGG - Intergenic
1183742682 22:39677555-39677577 CTGGGAGACCAGACAGCTGAGGG - Intronic
1184461972 22:44643360-44643382 CATGCAGACCACAGATTTGGTGG - Intergenic
953521578 3:43648235-43648257 CAGGGAAGACAAACATTTGGAGG + Intronic
956844822 3:73172946-73172968 ATGGGAGACCAGGTATTTGGTGG - Intergenic
957217053 3:77334205-77334227 CAGGGTGGCCAGAGATTTTGAGG + Intronic
957584959 3:82121209-82121231 CAGGGAGGTCACATATTTGGAGG + Intergenic
957981133 3:87511739-87511761 CTGGGGGATCAGAAATTTGGAGG + Intergenic
963574701 3:147045530-147045552 CAGGGAGACTAGTGATGTGGGGG - Intergenic
964255918 3:154773705-154773727 AAGGGAGCCCAGGCATTTGCTGG - Intergenic
968636801 4:1684924-1684946 CAGGGAGACCGGACTCTTGGGGG + Intergenic
968660388 4:1796375-1796397 CAGGGAGGCTGGACTTTTGGGGG + Intronic
968688265 4:1975925-1975947 CAGGAAGGACAGAGATTTGGGGG + Intronic
969443929 4:7233496-7233518 CAGGGTGAGCAGACACTTGCTGG + Intronic
970174935 4:13330223-13330245 CAGGGTGACCAGCCAGTTGCGGG + Intergenic
971442918 4:26709517-26709539 TACAGATACCAGACATTTGGAGG + Intronic
971595802 4:28526937-28526959 GAGGGAGACTGCACATTTGGGGG - Intergenic
971884459 4:32424971-32424993 CATGTAGACCACAGATTTGGTGG - Intergenic
977362951 4:96029489-96029511 GAGGGAGACCAGATATCTTGCGG - Intergenic
982537378 4:156623686-156623708 TCCAGAGACCAGACATTTGGAGG - Intergenic
985804681 5:2033783-2033805 CATCCTGACCAGACATTTGGGGG + Intergenic
985976951 5:3427157-3427179 TAGGGAGACCAGACCTATGATGG + Intergenic
987083257 5:14445332-14445354 CAGAGAAACTAGATATTTGGCGG - Intronic
989297238 5:39843792-39843814 CAGGGAGAACAGATGTTTGAAGG + Intergenic
991196144 5:63934804-63934826 CATGGAGGCCACAAATTTGGGGG + Intergenic
993036652 5:82766260-82766282 CAAGGACAACAGAGATTTGGGGG + Intergenic
995161199 5:108984928-108984950 CATGGAGATAAGACATTTAGAGG + Intronic
995172656 5:109135592-109135614 AAGGGAAACAAGACTTTTGGGGG + Intronic
997211946 5:132082023-132082045 CAGAGAGACCACACATAAGGAGG + Intergenic
999799815 5:155023070-155023092 CAAGTAGACCATACATTTTGGGG - Intergenic
1000097451 5:157984426-157984448 CAGGGTGATCAGACATCAGGGGG + Intergenic
1001473960 5:172036115-172036137 CAGGGAGGCCAGAAATGTAGAGG + Intergenic
1001632013 5:173182461-173182483 TAGGAAGACCAGAGATTTGATGG - Intergenic
1002647672 5:180669038-180669060 CATGGACAGCAGACATTTGAGGG + Intergenic
1003327722 6:5105446-5105468 CAGGGAGACCAGCTTTTCGGAGG - Intronic
1004076510 6:12348688-12348710 CAAGGAGACCACACAGGTGGGGG - Intergenic
1005121951 6:22399967-22399989 CATGGGGACCAGACCTTTAGAGG - Intergenic
1006907604 6:37543572-37543594 CAGGGACACCACAGCTTTGGAGG + Intergenic
1007094950 6:39207464-39207486 CAGGGAGCCCAGACAGGTGCAGG + Intronic
1012951346 6:105521362-105521384 CAGGGAGTCCAAATATATGGAGG - Intergenic
1013356177 6:109347746-109347768 CAGGTAGACATGAAATTTGGGGG + Intergenic
1014846734 6:126287010-126287032 TAGGAAGCCTAGACATTTGGTGG - Intergenic
1015547018 6:134371543-134371565 CAGGTAGACATGATATTTGGGGG + Intergenic
1016307256 6:142697037-142697059 CAGGGGGACCAGCTATTTTGAGG + Intergenic
1016744000 6:147558714-147558736 CAGTGGGCCCACACATTTGGAGG - Intronic
1018464538 6:164031755-164031777 CAGGAACACCTGAGATTTGGTGG - Intergenic
1019911927 7:4106009-4106031 AAGGGAGACCAGGCACTGGGCGG + Intronic
1022587494 7:31628340-31628362 CAGGGAGACCAGTCGTTTGTTGG - Intronic
1023018590 7:35989224-35989246 CAGAAAAACCAGACATTTAGAGG + Intergenic
1023616785 7:42028333-42028355 CTGGGAGACACGACATTTGGGGG + Intronic
1024290955 7:47803639-47803661 CAGGGAGAACAGACGTGGGGTGG - Intronic
1026297049 7:69062196-69062218 CAGGCTGCCCAGATATTTGGTGG - Intergenic
1026326491 7:69315060-69315082 GAGGTAGATGAGACATTTGGTGG - Intergenic
1027526319 7:79273736-79273758 TGGGGAGAACAGAAATTTGGGGG - Intronic
1032203217 7:129838398-129838420 CAGAGAGGCCACACATTTTGAGG + Intronic
1034721303 7:153295868-153295890 CAGGAAGACAAGGGATTTGGAGG + Intergenic
1035206589 7:157297548-157297570 CAGGATGACCGGGCATTTGGAGG - Intergenic
1041198077 8:55421435-55421457 CAGGGAGAGCTGACATTTGCAGG - Intronic
1041506442 8:58603713-58603735 CATGGAGACAGCACATTTGGAGG - Intronic
1044963776 8:97556241-97556263 CAAGGAGACAAGACCTTTGAAGG - Intergenic
1050412207 9:5378154-5378176 AAGGGCTACCAGACATTTGAGGG + Intronic
1050798521 9:9578464-9578486 CAAGGAGTCCAAAAATTTGGGGG + Intronic
1054762072 9:69012870-69012892 CAGGAAGCCCAGATATTTGGAGG - Exonic
1056315313 9:85383024-85383046 CAGGAAGTGGAGACATTTGGAGG - Intergenic
1058114678 9:101071306-101071328 GAGGAAGAACAGATATTTGGAGG + Intronic
1059350299 9:113659543-113659565 CAGGGAGATCAGACATCTGCTGG + Intergenic
1060656187 9:125374251-125374273 TAGGGACACCTGCCATTTGGAGG - Intergenic
1060944431 9:127561608-127561630 CAGGGAGCCCAGAGGTTTTGGGG - Intronic
1060981656 9:127795863-127795885 CAGGGTGACCAGACAGGTGGTGG + Intronic
1189474441 X:41339147-41339169 AAGGAAAACCAGGCATTTGGGGG + Intronic
1190221468 X:48514986-48515008 CAGGGAGCGCAGATATATGGGGG + Intronic
1191174516 X:57484966-57484988 CAGGCAGACCAGTCAGGTGGTGG + Intronic
1192331037 X:70175443-70175465 CAGGGAAAGCAGAGATATGGAGG - Intergenic
1192765366 X:74134219-74134241 CAGGGAGGGGAGACACTTGGAGG + Intergenic
1194973610 X:100371215-100371237 CAGGGATACCAAATGTTTGGTGG + Intronic
1196283360 X:113850416-113850438 CAGGGAGACCTGACTTTGGATGG - Intergenic
1199897291 X:152137398-152137420 CAGAAGGAGCAGACATTTGGCGG + Intronic
1199950022 X:152699633-152699655 CAGGGTGACCAGAGAGTTGAGGG + Intronic
1199959652 X:152768828-152768850 CAGGGTGACCAGAGAGTTGAGGG - Intronic
1200170842 X:154073199-154073221 CAGCGATAAGAGACATTTGGAGG + Intronic
1201021256 Y:9659622-9659644 CAGGGAGACCAAACAAATGATGG - Intergenic