ID: 1174910304

View in Genome Browser
Species Human (GRCh38)
Location 20:54600872-54600894
Sequence TTCTCTATGCTGGAGGTGTT AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1174910300_1174910304 13 Left 1174910300 20:54600836-54600858 CCTAGCAAAGGGCTATTTTTAGA 0: 1
1: 0
2: 0
3: 12
4: 214
Right 1174910304 20:54600872-54600894 TTCTCTATGCTGGAGGTGTTAGG No data
1174910297_1174910304 26 Left 1174910297 20:54600823-54600845 CCTTGCAGGAGATCCTAGCAAAG 0: 1
1: 0
2: 1
3: 7
4: 130
Right 1174910304 20:54600872-54600894 TTCTCTATGCTGGAGGTGTTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1174910304 Original CRISPR TTCTCTATGCTGGAGGTGTT AGG Intronic
No off target data available for this crispr