ID: 1174914802

View in Genome Browser
Species Human (GRCh38)
Location 20:54643460-54643482
Sequence CCCGCTCACTCATCTTCATC TGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 87
Summary {0: 1, 1: 0, 2: 2, 3: 7, 4: 77}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1174914802_1174914804 -2 Left 1174914802 20:54643460-54643482 CCAGATGAAGATGAGTGAGCGGG 0: 1
1: 0
2: 2
3: 7
4: 77
Right 1174914804 20:54643481-54643503 GGCCGCCTCGCTGAGCACCATGG 0: 1
1: 0
2: 0
3: 15
4: 133
1174914802_1174914810 24 Left 1174914802 20:54643460-54643482 CCAGATGAAGATGAGTGAGCGGG 0: 1
1: 0
2: 2
3: 7
4: 77
Right 1174914810 20:54643507-54643529 CCCTGCCTCGCAGCGCCTACTGG 0: 1
1: 0
2: 0
3: 12
4: 365

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1174914802 Original CRISPR CCCGCTCACTCATCTTCATC TGG (reversed) Exonic