ID: 1174914802 |
View in Genome Browser |
| Species | Human (GRCh38) |
| Location | 20:54643460-54643482 |
| Sequence | CCCGCTCACTCATCTTCATC TGG (reversed) |
| Strand | - |
| Crispr in exon? | Yes |
| Crispr in intron? | No |
| Off-Target Counts | All | Exonic | Intronic | Intergenic |
|---|---|---|---|---|
| Total | 87 | |||
| Summary | {0: 1, 1: 0, 2: 2, 3: 7, 4: 77} |
Found 2 Related Crispr Pairs
Show Crispr Pairs| ID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
|---|---|---|---|---|---|---|---|---|
| 1174914802_1174914804 | -2 | Left | 1174914802 | 20:54643460-54643482 | CCAGATGAAGATGAGTGAGCGGG | 0: 1 1: 0 2: 2 3: 7 4: 77 |
||
| Right | 1174914804 | 20:54643481-54643503 | GGCCGCCTCGCTGAGCACCATGG | 0: 1 1: 0 2: 0 3: 15 4: 133 |
||||
| 1174914802_1174914810 | 24 | Left | 1174914802 | 20:54643460-54643482 | CCAGATGAAGATGAGTGAGCGGG | 0: 1 1: 0 2: 2 3: 7 4: 77 |
||
| Right | 1174914810 | 20:54643507-54643529 | CCCTGCCTCGCAGCGCCTACTGG | 0: 1 1: 0 2: 0 3: 12 4: 365 |
Note: the row highlighted in blue is the original CRISPR
| WGE ID | Location | Sequence | Mismatches | Strand | Type |
|---|---|---|---|---|---|
| 1174914802 | Original CRISPR | CCCGCTCACTCATCTTCATC TGG (reversed) | Exonic | ||