ID: 1174916933

View in Genome Browser
Species Human (GRCh38)
Location 20:54663458-54663480
Sequence CCACTTTAGGAACTGTTGTG TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1174916928_1174916933 14 Left 1174916928 20:54663421-54663443 CCTTGAAATATCTTTTAGGGTTG No data
Right 1174916933 20:54663458-54663480 CCACTTTAGGAACTGTTGTGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1174916933 Original CRISPR CCACTTTAGGAACTGTTGTG TGG Intergenic
No off target data available for this crispr