ID: 1174932904

View in Genome Browser
Species Human (GRCh38)
Location 20:54834881-54834903
Sequence CATGGTTTCCAACCATCCAA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1174932901_1174932904 20 Left 1174932901 20:54834838-54834860 CCATTTCTGGATTTTATTTTTAT No data
Right 1174932904 20:54834881-54834903 CATGGTTTCCAACCATCCAATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1174932904 Original CRISPR CATGGTTTCCAACCATCCAA TGG Intergenic
No off target data available for this crispr