ID: 1174934217

View in Genome Browser
Species Human (GRCh38)
Location 20:54849921-54849943
Sequence CACTCTCTCATTGTGCTTCC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1174934212_1174934217 8 Left 1174934212 20:54849890-54849912 CCCTTCCCTGATTTGCTTTCTTC No data
Right 1174934217 20:54849921-54849943 CACTCTCTCATTGTGCTTCCTGG No data
1174934215_1174934217 2 Left 1174934215 20:54849896-54849918 CCTGATTTGCTTTCTTCACTTTC No data
Right 1174934217 20:54849921-54849943 CACTCTCTCATTGTGCTTCCTGG No data
1174934213_1174934217 7 Left 1174934213 20:54849891-54849913 CCTTCCCTGATTTGCTTTCTTCA No data
Right 1174934217 20:54849921-54849943 CACTCTCTCATTGTGCTTCCTGG No data
1174934214_1174934217 3 Left 1174934214 20:54849895-54849917 CCCTGATTTGCTTTCTTCACTTT No data
Right 1174934217 20:54849921-54849943 CACTCTCTCATTGTGCTTCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1174934217 Original CRISPR CACTCTCTCATTGTGCTTCC TGG Intergenic
No off target data available for this crispr