ID: 1174940912

View in Genome Browser
Species Human (GRCh38)
Location 20:54926118-54926140
Sequence TAGAATATACAGATAGGCAA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1174940912_1174940914 -9 Left 1174940912 20:54926118-54926140 CCATTGCCTATCTGTATATTCTA No data
Right 1174940914 20:54926132-54926154 TATATTCTACTCCAACCATGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1174940912 Original CRISPR TAGAATATACAGATAGGCAA TGG (reversed) Intergenic
No off target data available for this crispr