ID: 1174945453

View in Genome Browser
Species Human (GRCh38)
Location 20:54980305-54980327
Sequence GGCCATGGCAATGGGTCCTG TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1174945442_1174945453 15 Left 1174945442 20:54980267-54980289 CCTCCCACTGCACAGTCCTAATT No data
Right 1174945453 20:54980305-54980327 GGCCATGGCAATGGGTCCTGTGG No data
1174945443_1174945453 12 Left 1174945443 20:54980270-54980292 CCCACTGCACAGTCCTAATTAAA No data
Right 1174945453 20:54980305-54980327 GGCCATGGCAATGGGTCCTGTGG No data
1174945444_1174945453 11 Left 1174945444 20:54980271-54980293 CCACTGCACAGTCCTAATTAAAT No data
Right 1174945453 20:54980305-54980327 GGCCATGGCAATGGGTCCTGTGG No data
1174945446_1174945453 -1 Left 1174945446 20:54980283-54980305 CCTAATTAAATGGCTCTTCCTGG No data
Right 1174945453 20:54980305-54980327 GGCCATGGCAATGGGTCCTGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1174945453 Original CRISPR GGCCATGGCAATGGGTCCTG TGG Intergenic
No off target data available for this crispr