ID: 1174946860

View in Genome Browser
Species Human (GRCh38)
Location 20:54995732-54995754
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1174946860_1174946861 0 Left 1174946860 20:54995732-54995754 CCGCACGGGGTGACTCAGCTGTT No data
Right 1174946861 20:54995755-54995777 GTCAAGTAGTGAGTCACAGCAGG No data
1174946860_1174946866 27 Left 1174946860 20:54995732-54995754 CCGCACGGGGTGACTCAGCTGTT No data
Right 1174946866 20:54995782-54995804 ACTATGTAGGGGCTGCCACCCGG No data
1174946860_1174946865 16 Left 1174946860 20:54995732-54995754 CCGCACGGGGTGACTCAGCTGTT No data
Right 1174946865 20:54995771-54995793 CAGCAGGGCAGACTATGTAGGGG No data
1174946860_1174946864 15 Left 1174946860 20:54995732-54995754 CCGCACGGGGTGACTCAGCTGTT No data
Right 1174946864 20:54995770-54995792 ACAGCAGGGCAGACTATGTAGGG No data
1174946860_1174946863 14 Left 1174946860 20:54995732-54995754 CCGCACGGGGTGACTCAGCTGTT No data
Right 1174946863 20:54995769-54995791 CACAGCAGGGCAGACTATGTAGG No data
1174946860_1174946862 1 Left 1174946860 20:54995732-54995754 CCGCACGGGGTGACTCAGCTGTT No data
Right 1174946862 20:54995756-54995778 TCAAGTAGTGAGTCACAGCAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1174946860 Original CRISPR AACAGCTGAGTCACCCCGTG CGG (reversed) Intergenic