ID: 1174946861 |
View in Genome Browser |
Species | Human (GRCh38) |
Location | 20:54995755-54995777 |
Sequence | GTCAAGTAGTGAGTCACAGC AGG |
Strand | + |
Crispr in exon? | No |
Crispr in intron? | No |
Off-Target Counts | All | Exonic | Intronic | Intergenic |
---|---|---|---|---|
Total | ||||
Summary |
Found 1 Related Crispr Pairs
Show Crispr PairsID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
---|---|---|---|---|---|---|---|---|
1174946860_1174946861 | 0 | Left | 1174946860 | 20:54995732-54995754 | CCGCACGGGGTGACTCAGCTGTT | No data | ||
Right | 1174946861 | 20:54995755-54995777 | GTCAAGTAGTGAGTCACAGCAGG | No data |
Note: the row highlighted in blue is the original CRISPR
WGE ID | Location | Sequence | Mismatches | Strand | Type |
---|---|---|---|---|---|
1174946861 | Original CRISPR | GTCAAGTAGTGAGTCACAGC AGG | Intergenic | ||