ID: 1174946866

View in Genome Browser
Species Human (GRCh38)
Location 20:54995782-54995804
Sequence ACTATGTAGGGGCTGCCACC CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1174946860_1174946866 27 Left 1174946860 20:54995732-54995754 CCGCACGGGGTGACTCAGCTGTT No data
Right 1174946866 20:54995782-54995804 ACTATGTAGGGGCTGCCACCCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1174946866 Original CRISPR ACTATGTAGGGGCTGCCACC CGG Intergenic
No off target data available for this crispr