ID: 1174948120

View in Genome Browser
Species Human (GRCh38)
Location 20:55011287-55011309
Sequence CTAGTATTCTACATGGCTAT AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1174948117_1174948120 -7 Left 1174948117 20:55011271-55011293 CCTTAGATGCTATTACCTAGTAT No data
Right 1174948120 20:55011287-55011309 CTAGTATTCTACATGGCTATAGG No data
1174948115_1174948120 26 Left 1174948115 20:55011238-55011260 CCTTTATATATGTACTAAATTTT 0: 2
1: 0
2: 8
3: 95
4: 868
Right 1174948120 20:55011287-55011309 CTAGTATTCTACATGGCTATAGG No data
1174948116_1174948120 -6 Left 1174948116 20:55011270-55011292 CCCTTAGATGCTATTACCTAGTA No data
Right 1174948120 20:55011287-55011309 CTAGTATTCTACATGGCTATAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1174948120 Original CRISPR CTAGTATTCTACATGGCTAT AGG Intergenic
No off target data available for this crispr