ID: 1174954357

View in Genome Browser
Species Human (GRCh38)
Location 20:55080254-55080276
Sequence CTCTGCTGATACCTTGATTT TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1174954353_1174954357 4 Left 1174954353 20:55080227-55080249 CCCCAGAGCCTTCAGAAAAGTAC No data
Right 1174954357 20:55080254-55080276 CTCTGCTGATACCTTGATTTTGG No data
1174954356_1174954357 -4 Left 1174954356 20:55080235-55080257 CCTTCAGAAAAGTACTCAACTCT No data
Right 1174954357 20:55080254-55080276 CTCTGCTGATACCTTGATTTTGG No data
1174954354_1174954357 3 Left 1174954354 20:55080228-55080250 CCCAGAGCCTTCAGAAAAGTACT No data
Right 1174954357 20:55080254-55080276 CTCTGCTGATACCTTGATTTTGG No data
1174954355_1174954357 2 Left 1174954355 20:55080229-55080251 CCAGAGCCTTCAGAAAAGTACTC No data
Right 1174954357 20:55080254-55080276 CTCTGCTGATACCTTGATTTTGG No data
1174954352_1174954357 5 Left 1174954352 20:55080226-55080248 CCCCCAGAGCCTTCAGAAAAGTA No data
Right 1174954357 20:55080254-55080276 CTCTGCTGATACCTTGATTTTGG No data
1174954351_1174954357 30 Left 1174954351 20:55080201-55080223 CCAACTGAACTTGGAAGCAGATT No data
Right 1174954357 20:55080254-55080276 CTCTGCTGATACCTTGATTTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1174954357 Original CRISPR CTCTGCTGATACCTTGATTT TGG Intergenic
No off target data available for this crispr