ID: 1174955303

View in Genome Browser
Species Human (GRCh38)
Location 20:55091213-55091235
Sequence CCCTGCCAACTATTGGAACT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1174955303_1174955307 -10 Left 1174955303 20:55091213-55091235 CCAAGTTCCAATAGTTGGCAGGG No data
Right 1174955307 20:55091226-55091248 GTTGGCAGGGAACCCAGGTTTGG No data
1174955303_1174955310 12 Left 1174955303 20:55091213-55091235 CCAAGTTCCAATAGTTGGCAGGG No data
Right 1174955310 20:55091248-55091270 GTCAATTAAGTGATTGAATTAGG No data
1174955303_1174955311 25 Left 1174955303 20:55091213-55091235 CCAAGTTCCAATAGTTGGCAGGG No data
Right 1174955311 20:55091261-55091283 TTGAATTAGGTTCATTCTAGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1174955303 Original CRISPR CCCTGCCAACTATTGGAACT TGG (reversed) Intergenic
No off target data available for this crispr