ID: 1174959416

View in Genome Browser
Species Human (GRCh38)
Location 20:55138235-55138257
Sequence TAACCCATCCTGTTCCTTAG GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1174959410_1174959416 -2 Left 1174959410 20:55138214-55138236 CCATAGCCCTATCCTGGGGCTTA No data
Right 1174959416 20:55138235-55138257 TAACCCATCCTGTTCCTTAGGGG No data
1174959404_1174959416 26 Left 1174959404 20:55138186-55138208 CCACATCACTGATTCTGTTGATT No data
Right 1174959416 20:55138235-55138257 TAACCCATCCTGTTCCTTAGGGG No data
1174959403_1174959416 30 Left 1174959403 20:55138182-55138204 CCAACCACATCACTGATTCTGTT No data
Right 1174959416 20:55138235-55138257 TAACCCATCCTGTTCCTTAGGGG No data
1174959409_1174959416 -1 Left 1174959409 20:55138213-55138235 CCCATAGCCCTATCCTGGGGCTT No data
Right 1174959416 20:55138235-55138257 TAACCCATCCTGTTCCTTAGGGG No data
1174959411_1174959416 -8 Left 1174959411 20:55138220-55138242 CCCTATCCTGGGGCTTAACCCAT No data
Right 1174959416 20:55138235-55138257 TAACCCATCCTGTTCCTTAGGGG No data
1174959406_1174959416 3 Left 1174959406 20:55138209-55138231 CCATCCCATAGCCCTATCCTGGG No data
Right 1174959416 20:55138235-55138257 TAACCCATCCTGTTCCTTAGGGG No data
1174959412_1174959416 -9 Left 1174959412 20:55138221-55138243 CCTATCCTGGGGCTTAACCCATC No data
Right 1174959416 20:55138235-55138257 TAACCCATCCTGTTCCTTAGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1174959416 Original CRISPR TAACCCATCCTGTTCCTTAG GGG Intergenic
No off target data available for this crispr