ID: 1174961127

View in Genome Browser
Species Human (GRCh38)
Location 20:55158685-55158707
Sequence AGTTGAAACCTGGCCATTTG GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1174961123_1174961127 5 Left 1174961123 20:55158657-55158679 CCTGCTTCTGAGAATGATGGGTG No data
Right 1174961127 20:55158685-55158707 AGTTGAAACCTGGCCATTTGGGG No data
1174961120_1174961127 29 Left 1174961120 20:55158633-55158655 CCTTTCTATTCACATTTTGATTA No data
Right 1174961127 20:55158685-55158707 AGTTGAAACCTGGCCATTTGGGG No data
1174961119_1174961127 30 Left 1174961119 20:55158632-55158654 CCCTTTCTATTCACATTTTGATT No data
Right 1174961127 20:55158685-55158707 AGTTGAAACCTGGCCATTTGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1174961127 Original CRISPR AGTTGAAACCTGGCCATTTG GGG Intergenic
No off target data available for this crispr