ID: 1174970196

View in Genome Browser
Species Human (GRCh38)
Location 20:55266710-55266732
Sequence TCTTGTGGAGGACTGACTGG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1174970196_1174970202 20 Left 1174970196 20:55266710-55266732 CCCCCAGTCAGTCCTCCACAAGA No data
Right 1174970202 20:55266753-55266775 AAGAGTTCAAAGAGATTTTCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1174970196 Original CRISPR TCTTGTGGAGGACTGACTGG GGG (reversed) Intergenic