ID: 1174970197

View in Genome Browser
Species Human (GRCh38)
Location 20:55266711-55266733
Sequence GTCTTGTGGAGGACTGACTG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1174970197_1174970202 19 Left 1174970197 20:55266711-55266733 CCCCAGTCAGTCCTCCACAAGAC No data
Right 1174970202 20:55266753-55266775 AAGAGTTCAAAGAGATTTTCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1174970197 Original CRISPR GTCTTGTGGAGGACTGACTG GGG (reversed) Intergenic