ID: 1174970199

View in Genome Browser
Species Human (GRCh38)
Location 20:55266713-55266735
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1174970199_1174970202 17 Left 1174970199 20:55266713-55266735 CCAGTCAGTCCTCCACAAGACAA No data
Right 1174970202 20:55266753-55266775 AAGAGTTCAAAGAGATTTTCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1174970199 Original CRISPR TTGTCTTGTGGAGGACTGAC TGG (reversed) Intergenic