ID: 1174970200

View in Genome Browser
Species Human (GRCh38)
Location 20:55266722-55266744
Sequence AAATCTATATTGTCTTGTGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1174970200_1174970202 8 Left 1174970200 20:55266722-55266744 CCTCCACAAGACAATATAGATTT No data
Right 1174970202 20:55266753-55266775 AAGAGTTCAAAGAGATTTTCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1174970200 Original CRISPR AAATCTATATTGTCTTGTGG AGG (reversed) Intergenic
No off target data available for this crispr