ID: 1174970201 |
View in Genome Browser |
Species | Human (GRCh38) |
Location | 20:55266725-55266747 |
Sequence | TAAAAATCTATATTGTCTTG TGG (reversed) |
Strand | - |
Crispr in exon? | No |
Crispr in intron? | No |
Off-Target Counts | All | Exonic | Intronic | Intergenic |
---|---|---|---|---|
Total | ||||
Summary |
Found 1 Related Crispr Pairs
Show Crispr PairsID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
---|---|---|---|---|---|---|---|---|
1174970201_1174970202 | 5 | Left | 1174970201 | 20:55266725-55266747 | CCACAAGACAATATAGATTTTTA | No data | ||
Right | 1174970202 | 20:55266753-55266775 | AAGAGTTCAAAGAGATTTTCTGG | No data |
Note: the row highlighted in blue is the original CRISPR
WGE ID | Location | Sequence | Mismatches | Strand | Type |
---|---|---|---|---|---|
1174970201 | Original CRISPR | TAAAAATCTATATTGTCTTG TGG (reversed) | Intergenic | ||