ID: 1174970202

View in Genome Browser
Species Human (GRCh38)
Location 20:55266753-55266775
Sequence AAGAGTTCAAAGAGATTTTC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1174970198_1174970202 18 Left 1174970198 20:55266712-55266734 CCCAGTCAGTCCTCCACAAGACA No data
Right 1174970202 20:55266753-55266775 AAGAGTTCAAAGAGATTTTCTGG No data
1174970201_1174970202 5 Left 1174970201 20:55266725-55266747 CCACAAGACAATATAGATTTTTA No data
Right 1174970202 20:55266753-55266775 AAGAGTTCAAAGAGATTTTCTGG No data
1174970195_1174970202 21 Left 1174970195 20:55266709-55266731 CCCCCCAGTCAGTCCTCCACAAG No data
Right 1174970202 20:55266753-55266775 AAGAGTTCAAAGAGATTTTCTGG No data
1174970196_1174970202 20 Left 1174970196 20:55266710-55266732 CCCCCAGTCAGTCCTCCACAAGA No data
Right 1174970202 20:55266753-55266775 AAGAGTTCAAAGAGATTTTCTGG No data
1174970199_1174970202 17 Left 1174970199 20:55266713-55266735 CCAGTCAGTCCTCCACAAGACAA No data
Right 1174970202 20:55266753-55266775 AAGAGTTCAAAGAGATTTTCTGG No data
1174970200_1174970202 8 Left 1174970200 20:55266722-55266744 CCTCCACAAGACAATATAGATTT No data
Right 1174970202 20:55266753-55266775 AAGAGTTCAAAGAGATTTTCTGG No data
1174970197_1174970202 19 Left 1174970197 20:55266711-55266733 CCCCAGTCAGTCCTCCACAAGAC No data
Right 1174970202 20:55266753-55266775 AAGAGTTCAAAGAGATTTTCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1174970202 Original CRISPR AAGAGTTCAAAGAGATTTTC TGG Intergenic