ID: 1174975487

View in Genome Browser
Species Human (GRCh38)
Location 20:55328495-55328517
Sequence TCACCTCCATGCAGTTCTCA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1174975483_1174975487 22 Left 1174975483 20:55328450-55328472 CCCTTTATACTATAGGGCATTGT No data
Right 1174975487 20:55328495-55328517 TCACCTCCATGCAGTTCTCAAGG No data
1174975484_1174975487 21 Left 1174975484 20:55328451-55328473 CCTTTATACTATAGGGCATTGTT No data
Right 1174975487 20:55328495-55328517 TCACCTCCATGCAGTTCTCAAGG No data
1174975482_1174975487 26 Left 1174975482 20:55328446-55328468 CCAGCCCTTTATACTATAGGGCA No data
Right 1174975487 20:55328495-55328517 TCACCTCCATGCAGTTCTCAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1174975487 Original CRISPR TCACCTCCATGCAGTTCTCA AGG Intergenic
No off target data available for this crispr