ID: 1174978951

View in Genome Browser
Species Human (GRCh38)
Location 20:55369998-55370020
Sequence GGGATGCTCTGGTGCCTGGT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1174978951_1174978959 20 Left 1174978951 20:55369998-55370020 CCCACCAGGCACCAGAGCATCCC No data
Right 1174978959 20:55370041-55370063 CCCATGCGTCACCACAACCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1174978951 Original CRISPR GGGATGCTCTGGTGCCTGGT GGG (reversed) Intergenic
No off target data available for this crispr