ID: 1174983335

View in Genome Browser
Species Human (GRCh38)
Location 20:55421719-55421741
Sequence GACGGCATTCTGGGGGAGGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 206
Summary {0: 1, 1: 0, 2: 1, 3: 16, 4: 188}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1174983335_1174983344 -1 Left 1174983335 20:55421719-55421741 CCAGCCTCCCCCAGAATGCCGTC 0: 1
1: 0
2: 1
3: 16
4: 188
Right 1174983344 20:55421741-55421763 CTTGGTTTGAATTCCTGGAGCGG 0: 1
1: 0
2: 0
3: 58
4: 175
1174983335_1174983345 4 Left 1174983335 20:55421719-55421741 CCAGCCTCCCCCAGAATGCCGTC 0: 1
1: 0
2: 1
3: 16
4: 188
Right 1174983345 20:55421746-55421768 TTTGAATTCCTGGAGCGGTGTGG 0: 1
1: 0
2: 1
3: 12
4: 114
1174983335_1174983342 -6 Left 1174983335 20:55421719-55421741 CCAGCCTCCCCCAGAATGCCGTC 0: 1
1: 0
2: 1
3: 16
4: 188
Right 1174983342 20:55421736-55421758 GCCGTCTTGGTTTGAATTCCTGG 0: 1
1: 0
2: 0
3: 6
4: 94
1174983335_1174983347 6 Left 1174983335 20:55421719-55421741 CCAGCCTCCCCCAGAATGCCGTC 0: 1
1: 0
2: 1
3: 16
4: 188
Right 1174983347 20:55421748-55421770 TGAATTCCTGGAGCGGTGTGGGG 0: 1
1: 0
2: 1
3: 10
4: 199
1174983335_1174983346 5 Left 1174983335 20:55421719-55421741 CCAGCCTCCCCCAGAATGCCGTC 0: 1
1: 0
2: 1
3: 16
4: 188
Right 1174983346 20:55421747-55421769 TTGAATTCCTGGAGCGGTGTGGG 0: 1
1: 0
2: 0
3: 6
4: 87

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1174983335 Original CRISPR GACGGCATTCTGGGGGAGGC TGG (reversed) Intergenic
901438298 1:9262744-9262766 CAGGGCTTTCTGGGAGAGGCTGG + Intronic
901761561 1:11475099-11475121 TGCAGAATTCTGGGGGAGGCAGG + Intergenic
903293102 1:22326986-22327008 GAAGGCTTCCTGGAGGAGGCAGG - Intergenic
903325246 1:22565478-22565500 GACGGCTTTCTGAGGGTGGGTGG + Intronic
904464034 1:30697584-30697606 GCTGGAATTCTGGAGGAGGCCGG + Intergenic
905316393 1:37084225-37084247 GAAGGCGCCCTGGGGGAGGCTGG + Intergenic
906634251 1:47397833-47397855 GAAGGCCTTCTGGAGGAGGCAGG - Intergenic
907476542 1:54709747-54709769 GAAGGCTTCCTGGAGGAGGCAGG + Intronic
908254568 1:62292492-62292514 GATGGCTTCCTGGGGGAGGTGGG - Intronic
913196197 1:116458168-116458190 GACGGCATTCAGGGTGCAGCTGG + Intergenic
915225063 1:154405778-154405800 CACCGCAGTCTGTGGGAGGCTGG + Intronic
915597308 1:156902909-156902931 CAGGGCAGTCTGAGGGAGGCGGG + Intronic
919398975 1:197085022-197085044 GACAGCATTCTGGTGGATGTTGG - Intronic
919770982 1:201158419-201158441 GAGGGCATTCTGGTGGGGGGTGG + Intronic
919870884 1:201820334-201820356 GAGGGAGATCTGGGGGAGGCAGG + Exonic
921249962 1:213288238-213288260 GACTTCATACTGGGGGAGGAAGG + Intergenic
922078471 1:222271164-222271186 GAGGTCATACTGGGGGAGGGTGG - Intergenic
923569293 1:235099841-235099863 GGCAGCAACCTGGGGGAGGCTGG - Intergenic
1063385987 10:5616528-5616550 GACGGCACTCGGGGGGTGGGCGG - Intergenic
1065916502 10:30358171-30358193 GAAGGGACCCTGGGGGAGGCAGG - Intronic
1067448393 10:46366933-46366955 CATGGCCTTCTGGGTGAGGCTGG - Intergenic
1067588982 10:47493833-47493855 CATGGCCTTCTGGGCGAGGCTGG + Intergenic
1067636107 10:48001924-48001946 CATGGCCTTCTGGGCGAGGCTGG + Intergenic
1070728333 10:78807681-78807703 GGCAGGATGCTGGGGGAGGCAGG + Intergenic
1073633956 10:105178130-105178152 GACGGGGCTCTGGTGGAGGCAGG + Exonic
1074578872 10:114697072-114697094 CAGGGCACTCTGGGGGAGGAAGG + Intergenic
1075293664 10:121253301-121253323 GAGGGCTTCCTGGGGGAAGCAGG - Intergenic
1075733128 10:124648121-124648143 GAGGGTTTTCTGGAGGAGGCAGG - Intronic
1075894241 10:125980887-125980909 GATGGCCTTCTGGGGGCGGGGGG - Intronic
1075953837 10:126505446-126505468 GACAGAATTCTGGAGGTGGCTGG + Intronic
1083190511 11:61048617-61048639 GAAGGCTTCCTGGAGGAGGCAGG - Intergenic
1083607704 11:63988640-63988662 CACAGCAATCTGGAGGAGGCAGG - Exonic
1084223340 11:67698449-67698471 GACAGCCTCCTGGGGGAGACAGG - Intergenic
1084550139 11:69836220-69836242 GAGGGCATGCTGGGGGAGGGCGG - Intergenic
1084590245 11:70086023-70086045 GACGGCATGCTGCGCCAGGCAGG - Intronic
1084941412 11:72615276-72615298 GAGGTCATTTTGGAGGAGGCAGG - Intronic
1085532197 11:77198498-77198520 GACGTCGTTCTTGGGGAGACTGG - Exonic
1089444973 11:118544720-118544742 GACAGCAATCTGAGGCAGGCAGG + Exonic
1091026927 11:132149734-132149756 AAGGGCATCCTGGGGGAGGAGGG + Intronic
1091419538 12:324369-324391 GGAGGCATTTTGGGGGTGGCCGG + Intronic
1092077188 12:5683805-5683827 GAGGGCTTCCTGGAGGAGGCAGG + Intronic
1092113906 12:5985070-5985092 GTCTGCATTCTGGCGGAGGCGGG + Exonic
1093372815 12:18385457-18385479 GATTGCATTCGGGGAGAGGCAGG - Intronic
1094492630 12:30970538-30970560 GAGGGCATGCTGGAAGAGGCAGG - Intronic
1096181976 12:49556075-49556097 GAAGGCTTCCTGGAGGAGGCAGG - Intronic
1096255328 12:50058737-50058759 GAGGGGATCCTGGGGGAGGAGGG - Exonic
1097493341 12:60297186-60297208 GAGGGCAACCTGGAGGAGGCTGG - Intergenic
1103015002 12:117487459-117487481 GACAGCAACCTGGGGGATGCAGG - Intronic
1103415158 12:120738406-120738428 GACAGCATCCTGGGGGAGCCAGG + Exonic
1104054415 12:125218516-125218538 CATGGCATTCTGGGGTAGGAGGG + Intronic
1106209742 13:27630867-27630889 GACAGCAGGGTGGGGGAGGCGGG - Intronic
1107052000 13:36060863-36060885 CACGGCATTCTGGGGGCTGTTGG - Intronic
1110602218 13:77388034-77388056 GAAAGCAATCTGGGGGAAGCAGG + Intergenic
1117315104 14:54565978-54566000 GACGGCACGCGGGGGGAGCCGGG - Intergenic
1117321574 14:54628956-54628978 TTTGACATTCTGGGGGAGGCAGG - Intronic
1118646217 14:67843294-67843316 GACAGCATTGTGGGGGAGGGGGG - Intronic
1119528662 14:75343606-75343628 GATGGCTTTTTGGAGGAGGCAGG + Intergenic
1121309097 14:92925300-92925322 GAGGGCATTTTCTGGGAGGCAGG - Intronic
1122125159 14:99574894-99574916 GAAGCCATTCTGTGGGACGCTGG + Intronic
1122273291 14:100577974-100577996 GACGGCGCTCTTGGGGAGCCCGG - Intronic
1124490360 15:30151475-30151497 GAAGGGACCCTGGGGGAGGCAGG + Intergenic
1124753173 15:32386854-32386876 GAAGGGACCCTGGGGGAGGCAGG - Intergenic
1124974912 15:34522554-34522576 GAAGGGACCCTGGGGGAGGCAGG - Intergenic
1126877115 15:53055602-53055624 TACGGCCTGTTGGGGGAGGCTGG + Intergenic
1127313145 15:57770172-57770194 GAAGGCATTCTGGGGAAGGCTGG - Intronic
1128232142 15:66042838-66042860 GAGGTCATACTGGAGGAGGCTGG - Intronic
1128333969 15:66774319-66774341 GACTGCAGTCTGAGGGAGGCGGG - Intronic
1129868896 15:78928662-78928684 GGCGGCATTCTGATCGAGGCAGG + Intronic
1131085609 15:89573340-89573362 GATCACATTCTGGGGGATGCTGG - Intergenic
1131173944 15:90198431-90198453 GTCAGCATTCTGGGGGAGATGGG + Intronic
1131310441 15:91285770-91285792 GAGGAAGTTCTGGGGGAGGCAGG + Intronic
1132588682 16:717025-717047 GTAGGCATTCAGGGGAAGGCAGG - Intronic
1132745310 16:1433882-1433904 GAGGGCTTTCTTGGAGAGGCAGG + Intergenic
1133706252 16:8357859-8357881 GACAACATCCTGGGGCAGGCAGG - Intergenic
1134104613 16:11476890-11476912 GCGGGCATCCTGGGGCAGGCCGG - Exonic
1137794387 16:51203031-51203053 GAAGGTGTTCTGAGGGAGGCAGG - Intergenic
1139330931 16:66189361-66189383 GGCTGTCTTCTGGGGGAGGCTGG + Intergenic
1139471696 16:67181335-67181357 GAGGGCATTCTGGGGGGTACCGG - Intronic
1139560125 16:67736594-67736616 GAAGGCTTGCTGGAGGAGGCGGG - Intronic
1141656305 16:85418481-85418503 GAGGGCTTCCTGGAGGAGGCGGG - Intergenic
1142194084 16:88731618-88731640 GACAGGAGTCTGGGGCAGGCGGG + Intronic
1142229952 16:88895499-88895521 GGAGGCAATCTGGGGGAGCCGGG - Intronic
1142593659 17:1019230-1019252 GAAGGCTCTCTGGAGGAGGCGGG - Intronic
1142955842 17:3521211-3521233 GAAGGCTTCCTGGAGGAGGCAGG - Intronic
1143335437 17:6168654-6168676 CAAGGCATTTTGGGGGAGGGGGG + Intergenic
1143453448 17:7050774-7050796 GAGGGCATTCTGGGGGGTGAGGG - Intergenic
1146926955 17:36751823-36751845 TAGGCCATTCTGGGAGAGGCGGG + Intergenic
1149041036 17:52188306-52188328 GAATGCACACTGGGGGAGGCTGG - Intergenic
1149642063 17:58209381-58209403 GCTGACATTCTGGGGGAAGCAGG + Intronic
1151835932 17:76582794-76582816 GACGGCATTCTGGGCAGAGCCGG - Intronic
1152044803 17:77928962-77928984 GACAGCAGCCTGGGGGAGGGGGG - Intergenic
1152519217 17:80845585-80845607 GAGGGCATCCTCGGGCAGGCTGG - Intronic
1152616035 17:81338318-81338340 GAAGGCCTTCTGGGGGAGTGTGG - Intergenic
1153349225 18:4059919-4059941 GAGGGCATCCTGGAGGGGGCCGG - Intronic
1153734450 18:8050348-8050370 GAAGGCATTCTGGCAGTGGCTGG + Intronic
1154194278 18:12254430-12254452 CACGGCAATCAGGGGGACGCGGG - Intronic
1155285510 18:24284880-24284902 GAAGGCTTCCTGGGGGAGGATGG - Intronic
1157622836 18:49026112-49026134 GACAGCTTCCTGGAGGAGGCGGG + Intergenic
1157685744 18:49640988-49641010 GCCGGCATTCCTGGGGAGGTGGG + Intergenic
1158349182 18:56547596-56547618 GACGGGACTATGGGGGAGCCAGG + Intergenic
1161558041 19:4955445-4955467 GAAAGCATCCTGGGTGAGGCGGG - Intronic
1162974827 19:14202798-14202820 GTGGTCATGCTGGGGGAGGCAGG - Intronic
1164724574 19:30457561-30457583 GAGAGCACTCTGGGGGACGCAGG + Intronic
1165723127 19:38093706-38093728 GACGGCCATCTGGGGCAGGCTGG - Intronic
1167092643 19:47355136-47355158 GACCTCATACTGGGGCAGGCTGG - Exonic
930013706 2:46956711-46956733 GAAGGCTTTCTGGAGGAGGAGGG + Intronic
932213239 2:69948801-69948823 GACGGCATTCGCGGGAGGGCAGG - Intergenic
934779554 2:96960888-96960910 GACGGCATCCTGGGAGGGGCAGG + Intronic
934904581 2:98187494-98187516 GAGACCATTCTGGAGGAGGCAGG - Intronic
935175099 2:100642443-100642465 CACAGCCCTCTGGGGGAGGCAGG - Intergenic
937497187 2:122433029-122433051 GGCAGCAATCTGGGGGAAGCAGG + Intergenic
938194116 2:129311073-129311095 TGCAGCATTCTGGGGAAGGCTGG - Intergenic
939043423 2:137220956-137220978 TATGACATTCTGGGGGAGGAGGG + Intronic
941381235 2:164794789-164794811 GAAGGCATTCTGGGGCAAGAGGG - Intronic
942073110 2:172332926-172332948 GAGGTCATTCTGGGGCAGGGTGG + Intergenic
944587468 2:201185344-201185366 CAAAGCAATCTGGGGGAGGCAGG - Intronic
946426464 2:219600844-219600866 GGCGGCTTCCTGGAGGAGGCTGG + Intronic
948691283 2:239706691-239706713 GAGGGCACTCTGGAGGAGGAAGG + Intergenic
1168892565 20:1304580-1304602 GTCGGCATTCTGGGGGTGGTGGG + Intronic
1169233380 20:3908771-3908793 GAAAGCATTCTGGGAGAGGAGGG - Intronic
1170012161 20:11736060-11736082 GATGCCATGCTGGCGGAGGCTGG - Intergenic
1172657263 20:36544782-36544804 AAAGCCAGTCTGGGGGAGGCAGG + Intronic
1174983335 20:55421719-55421741 GACGGCATTCTGGGGGAGGCTGG - Intergenic
1175108894 20:56631791-56631813 GTCGACATTCTGGGGGAGAGAGG - Exonic
1176004084 20:62850367-62850389 CTCGGCATTCTGGGGGCGTCAGG - Intronic
1177323836 21:19557327-19557349 GACGATATTCAGGGGGAGGGTGG + Intergenic
1178403514 21:32306650-32306672 GATCGCATTCTGGGTGAGCCTGG + Exonic
1180635060 22:17257461-17257483 GACTGGCCTCTGGGGGAGGCGGG + Intergenic
1180725792 22:17945703-17945725 GAAGGCATTCTGGGTGGGGGAGG - Intronic
1181310141 22:21940126-21940148 GACGTCATGCTGGAGCAGGCTGG + Intronic
1182771885 22:32802084-32802106 GAAGGCGTCCTGGGGGTGGCTGG - Exonic
1183122252 22:35739098-35739120 GAAGTGATTCTGGGGGAGGACGG + Intronic
1184175880 22:42788467-42788489 GAAGGGACCCTGGGGGAGGCAGG + Intergenic
1185337000 22:50275202-50275224 GCCGGCACCCTTGGGGAGGCCGG + Exonic
950651049 3:14406874-14406896 GAGGGAATGATGGGGGAGGCAGG + Intronic
953782483 3:45883980-45884002 CACGCCATTCTGGGGTAGGTTGG + Intronic
955242362 3:57189619-57189641 GAGGGAATTTTGGGGGAGGATGG - Intergenic
959629728 3:108494094-108494116 GAAGACAGCCTGGGGGAGGCTGG + Intronic
960986370 3:123283854-123283876 GACGCCACTCGGGGGGAGGGCGG - Exonic
961456926 3:127028979-127029001 GGCGCCACTCTGGGGGAGGAGGG - Exonic
961540893 3:127598557-127598579 GGCGGCGCTCTGGGTGAGGCTGG + Intronic
962243157 3:133768326-133768348 GTCAGCATCCTGGGGGAGTCTGG - Intronic
968425782 4:522377-522399 GGATGCATTCTGGGGGTGGCAGG - Intronic
968920759 4:3521213-3521235 GACCCCATTCTGTGGGAGGCGGG - Intronic
968953741 4:3707817-3707839 GAGGGGGTTCTGGAGGAGGCTGG + Intergenic
969007991 4:4037054-4037076 GCCGTCCTTCTGGGGGAGCCCGG + Intergenic
969115380 4:4867622-4867644 GAGGGCGCTGTGGGGGAGGCAGG - Intergenic
972466780 4:39365313-39365335 GACAACATTCTGGGGGGGGGCGG - Intronic
973226696 4:47793144-47793166 GACAGCATTGTGGGGGAGTCTGG - Intronic
974892251 4:67896605-67896627 GATGGCACTCATGGGGAGGCTGG + Intergenic
976483237 4:85569431-85569453 GTGGACATTCTGGGGGAGCCAGG - Intronic
977928013 4:102722915-102722937 GAGGGCAGTCTGGGGGAACCTGG + Exonic
985619673 5:947586-947608 CACGGGATACTGGGGCAGGCGGG + Intergenic
985677325 5:1238761-1238783 GACAGGGTTCTGGGAGAGGCTGG + Intronic
986134381 5:4960531-4960553 GACAGCATTCTGGGTGTGGCAGG - Intergenic
992493705 5:77271015-77271037 GATGGCATTGTGGGGGACACTGG + Intronic
994599188 5:101880596-101880618 GACAGCATTCTGAGGTAAGCAGG - Intergenic
997436629 5:133880387-133880409 GAGGGCTTCCTGGAGGAGGCAGG - Intergenic
999212159 5:149899312-149899334 GTCAGCTTGCTGGGGGAGGCTGG - Intronic
999673886 5:153980276-153980298 GAAGGCTTTCTGGAGGAGGCTGG + Intergenic
1002209512 5:177588784-177588806 GATGGCGCTCTGGGGGAGGCAGG - Intergenic
1006297437 6:33176169-33176191 GACGGCAGTGCGGGGCAGGCTGG + Intronic
1006441952 6:34058585-34058607 GAGGGGATTCAGGGTGAGGCAGG + Intronic
1006743835 6:36327472-36327494 GACAGCTTTCTGAGGGAGGCAGG - Intronic
1007788956 6:44297947-44297969 GTGGGCTTTCTGCGGGAGGCGGG + Intronic
1009697967 6:67134270-67134292 GACCTCATTGTGGGAGAGGCAGG - Intergenic
1011355949 6:86473604-86473626 GCCGTCCTTCTGGGGGAGCCCGG - Intergenic
1013583561 6:111559330-111559352 GACAGCATTCTGGCTGAGGCTGG - Exonic
1017276967 6:152581130-152581152 GAGGGCATTCTCAGGGAAGCAGG - Intronic
1018383848 6:163285159-163285181 GAGGGGTGTCTGGGGGAGGCTGG - Intronic
1019132026 6:169883828-169883850 GACTGCCTTCTGGGGGACCCTGG - Intergenic
1021626513 7:22598830-22598852 GCCAGCAACCTGGGGGAGGCAGG - Intronic
1022666485 7:32416053-32416075 GAAGGCTGCCTGGGGGAGGCGGG - Intergenic
1023964610 7:44956516-44956538 GGCTGCATTCTAGGGGAGGGGGG + Intergenic
1026901827 7:74041539-74041561 GAAGGCATTCTAGAGGAGGTGGG + Intronic
1029374739 7:100170959-100170981 GGGGGCAATTTGGGGGAGGCTGG - Intronic
1029440489 7:100584403-100584425 GCCGGAATGCTGGGGGAGGAGGG + Intronic
1029975737 7:104831539-104831561 GAGGGCATTCTGGAGGAGAGGGG - Intronic
1033348143 7:140541271-140541293 GGAGGGAGTCTGGGGGAGGCTGG + Intronic
1033551702 7:142453265-142453287 AATGGCATTCTGGGAAAGGCAGG + Intergenic
1035456310 7:159011214-159011236 GAGGGCATTCTGGGTGTGGAGGG + Intergenic
1035822567 8:2610330-2610352 GAGGTCATTCTGGAGCAGGCTGG + Intergenic
1036882775 8:12526719-12526741 GCCGTCCTTCTGGGGGAGCCCGG + Intergenic
1038545362 8:28422110-28422132 GTTGGCATTCTGGGGTAGGGTGG + Intronic
1041459997 8:58100712-58100734 GAGGTCATTCTGGAGTAGGCTGG - Intronic
1042349732 8:67765016-67765038 GACAGAATTCAGGGGGAGGGTGG - Intergenic
1053066740 9:35074408-35074430 CACTGCACTCTGGTGGAGGCTGG - Exonic
1055005799 9:71504571-71504593 GAGGGCATTCTGGAGAAGGTAGG + Intergenic
1056794630 9:89649160-89649182 TACGGAACTATGGGGGAGGCGGG + Intergenic
1057903011 9:98964149-98964171 TGCACCATTCTGGGGGAGGCTGG + Intronic
1058765886 9:108182420-108182442 GACATCATTCTGGGCGAGGGAGG - Intergenic
1058936278 9:109772358-109772380 GAAGGCATACTTGGGGAGGTGGG - Intronic
1059406031 9:114098681-114098703 CGGGGCATTCTGGGGGGGGCGGG + Intronic
1060206921 9:121687520-121687542 GCGGGCATTGTGGGAGAGGCAGG + Intronic
1061002434 9:127910050-127910072 GACTGCCTCCTGGGGGTGGCGGG + Exonic
1061061756 9:128254113-128254135 GAAGGGACCCTGGGGGAGGCAGG - Intronic
1061670047 9:132183512-132183534 GAAGGCTTCCTGGGGGAGGTGGG - Intronic
1061789343 9:133050839-133050861 GATGGCATTGTGGGGGCGCCGGG - Exonic
1061973387 9:134056514-134056536 CAAGGGCTTCTGGGGGAGGCAGG - Intronic
1190333924 X:49251475-49251497 GATGGCGTTCTGTGGAAGGCCGG + Exonic
1192260860 X:69505214-69505236 GACGGCCGTCTGGGGCGGGCGGG - Intergenic
1193607173 X:83583269-83583291 GAGGTCATACTGGGGTAGGCTGG - Intergenic
1196425289 X:115562507-115562529 GACGGGATGCTGGGGGCGCCCGG + Intronic
1196687545 X:118524895-118524917 GCCAGCATTTTGGGAGAGGCAGG + Intronic
1199600179 X:149537011-149537033 GGCAGTATCCTGGGGGAGGCAGG + Intergenic
1199650404 X:149942929-149942951 GGCAGTATCCTGGGGGAGGCAGG - Intergenic