ID: 1175001220

View in Genome Browser
Species Human (GRCh38)
Location 20:55632662-55632684
Sequence GGCAGGCATGGGATTGAGAC CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1175001220_1175001229 1 Left 1175001220 20:55632662-55632684 CCGGTCTCAATCCCATGCCTGCC No data
Right 1175001229 20:55632686-55632708 CGGGCGAGACAGGTGTGGAGTGG No data
1175001220_1175001227 -4 Left 1175001220 20:55632662-55632684 CCGGTCTCAATCCCATGCCTGCC No data
Right 1175001227 20:55632681-55632703 TGCCACGGGCGAGACAGGTGTGG No data
1175001220_1175001232 8 Left 1175001220 20:55632662-55632684 CCGGTCTCAATCCCATGCCTGCC No data
Right 1175001232 20:55632693-55632715 GACAGGTGTGGAGTGGCAAGGGG No data
1175001220_1175001233 26 Left 1175001220 20:55632662-55632684 CCGGTCTCAATCCCATGCCTGCC No data
Right 1175001233 20:55632711-55632733 AGGGGTGTGTGAGCAAGTGTAGG 0: 13
1: 20
2: 73
3: 110
4: 530
1175001220_1175001234 27 Left 1175001220 20:55632662-55632684 CCGGTCTCAATCCCATGCCTGCC No data
Right 1175001234 20:55632712-55632734 GGGGTGTGTGAGCAAGTGTAGGG No data
1175001220_1175001230 6 Left 1175001220 20:55632662-55632684 CCGGTCTCAATCCCATGCCTGCC No data
Right 1175001230 20:55632691-55632713 GAGACAGGTGTGGAGTGGCAAGG No data
1175001220_1175001225 -9 Left 1175001220 20:55632662-55632684 CCGGTCTCAATCCCATGCCTGCC No data
Right 1175001225 20:55632676-55632698 ATGCCTGCCACGGGCGAGACAGG No data
1175001220_1175001231 7 Left 1175001220 20:55632662-55632684 CCGGTCTCAATCCCATGCCTGCC No data
Right 1175001231 20:55632692-55632714 AGACAGGTGTGGAGTGGCAAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1175001220 Original CRISPR GGCAGGCATGGGATTGAGAC CGG (reversed) Intergenic
No off target data available for this crispr