ID: 1175001225

View in Genome Browser
Species Human (GRCh38)
Location 20:55632676-55632698
Sequence ATGCCTGCCACGGGCGAGAC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1175001220_1175001225 -9 Left 1175001220 20:55632662-55632684 CCGGTCTCAATCCCATGCCTGCC No data
Right 1175001225 20:55632676-55632698 ATGCCTGCCACGGGCGAGACAGG No data
1175001215_1175001225 27 Left 1175001215 20:55632626-55632648 CCCACTCAGCCTGGCAGGCTGTG No data
Right 1175001225 20:55632676-55632698 ATGCCTGCCACGGGCGAGACAGG No data
1175001217_1175001225 18 Left 1175001217 20:55632635-55632657 CCTGGCAGGCTGTGCTCACCTTC No data
Right 1175001225 20:55632676-55632698 ATGCCTGCCACGGGCGAGACAGG No data
1175001219_1175001225 0 Left 1175001219 20:55632653-55632675 CCTTCACTACCGGTCTCAATCCC No data
Right 1175001225 20:55632676-55632698 ATGCCTGCCACGGGCGAGACAGG No data
1175001214_1175001225 30 Left 1175001214 20:55632623-55632645 CCGCCCACTCAGCCTGGCAGGCT No data
Right 1175001225 20:55632676-55632698 ATGCCTGCCACGGGCGAGACAGG No data
1175001216_1175001225 26 Left 1175001216 20:55632627-55632649 CCACTCAGCCTGGCAGGCTGTGC No data
Right 1175001225 20:55632676-55632698 ATGCCTGCCACGGGCGAGACAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1175001225 Original CRISPR ATGCCTGCCACGGGCGAGAC AGG Intergenic