ID: 1175001229

View in Genome Browser
Species Human (GRCh38)
Location 20:55632686-55632708
Sequence CGGGCGAGACAGGTGTGGAG TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1175001219_1175001229 10 Left 1175001219 20:55632653-55632675 CCTTCACTACCGGTCTCAATCCC No data
Right 1175001229 20:55632686-55632708 CGGGCGAGACAGGTGTGGAGTGG No data
1175001220_1175001229 1 Left 1175001220 20:55632662-55632684 CCGGTCTCAATCCCATGCCTGCC No data
Right 1175001229 20:55632686-55632708 CGGGCGAGACAGGTGTGGAGTGG No data
1175001217_1175001229 28 Left 1175001217 20:55632635-55632657 CCTGGCAGGCTGTGCTCACCTTC No data
Right 1175001229 20:55632686-55632708 CGGGCGAGACAGGTGTGGAGTGG No data
1175001223_1175001229 -10 Left 1175001223 20:55632673-55632695 CCCATGCCTGCCACGGGCGAGAC No data
Right 1175001229 20:55632686-55632708 CGGGCGAGACAGGTGTGGAGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1175001229 Original CRISPR CGGGCGAGACAGGTGTGGAG TGG Intergenic