ID: 1175001234

View in Genome Browser
Species Human (GRCh38)
Location 20:55632712-55632734
Sequence GGGGTGTGTGAGCAAGTGTA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1175001226_1175001234 10 Left 1175001226 20:55632679-55632701 CCTGCCACGGGCGAGACAGGTGT No data
Right 1175001234 20:55632712-55632734 GGGGTGTGTGAGCAAGTGTAGGG No data
1175001228_1175001234 6 Left 1175001228 20:55632683-55632705 CCACGGGCGAGACAGGTGTGGAG No data
Right 1175001234 20:55632712-55632734 GGGGTGTGTGAGCAAGTGTAGGG No data
1175001224_1175001234 15 Left 1175001224 20:55632674-55632696 CCATGCCTGCCACGGGCGAGACA No data
Right 1175001234 20:55632712-55632734 GGGGTGTGTGAGCAAGTGTAGGG No data
1175001223_1175001234 16 Left 1175001223 20:55632673-55632695 CCCATGCCTGCCACGGGCGAGAC No data
Right 1175001234 20:55632712-55632734 GGGGTGTGTGAGCAAGTGTAGGG No data
1175001220_1175001234 27 Left 1175001220 20:55632662-55632684 CCGGTCTCAATCCCATGCCTGCC No data
Right 1175001234 20:55632712-55632734 GGGGTGTGTGAGCAAGTGTAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1175001234 Original CRISPR GGGGTGTGTGAGCAAGTGTA GGG Intergenic