ID: 1175001638

View in Genome Browser
Species Human (GRCh38)
Location 20:55635513-55635535
Sequence ACAAACAAACAGAAACTGGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1175001638_1175001643 12 Left 1175001638 20:55635513-55635535 CCCTCCAGTTTCTGTTTGTTTGT No data
Right 1175001643 20:55635548-55635570 ACATTGAGATACAGAAGACAAGG No data
1175001638_1175001644 28 Left 1175001638 20:55635513-55635535 CCCTCCAGTTTCTGTTTGTTTGT No data
Right 1175001644 20:55635564-55635586 GACAAGGACACTCATGTAGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1175001638 Original CRISPR ACAAACAAACAGAAACTGGA GGG (reversed) Intergenic
No off target data available for this crispr