ID: 1175007136

View in Genome Browser
Species Human (GRCh38)
Location 20:55696615-55696637
Sequence CCAGCAAACAACTATAAATC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1175007128_1175007136 22 Left 1175007128 20:55696570-55696592 CCCTTCCTTGTGGATTCCTTTGA No data
Right 1175007136 20:55696615-55696637 CCAGCAAACAACTATAAATCTGG No data
1175007129_1175007136 21 Left 1175007129 20:55696571-55696593 CCTTCCTTGTGGATTCCTTTGAA No data
Right 1175007136 20:55696615-55696637 CCAGCAAACAACTATAAATCTGG No data
1175007127_1175007136 30 Left 1175007127 20:55696562-55696584 CCAAGCTTCCCTTCCTTGTGGAT No data
Right 1175007136 20:55696615-55696637 CCAGCAAACAACTATAAATCTGG No data
1175007131_1175007136 6 Left 1175007131 20:55696586-55696608 CCTTTGAAAATATGATGCTGTAT No data
Right 1175007136 20:55696615-55696637 CCAGCAAACAACTATAAATCTGG No data
1175007130_1175007136 17 Left 1175007130 20:55696575-55696597 CCTTGTGGATTCCTTTGAAAATA No data
Right 1175007136 20:55696615-55696637 CCAGCAAACAACTATAAATCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1175007136 Original CRISPR CCAGCAAACAACTATAAATC TGG Intergenic
No off target data available for this crispr