ID: 1175007285

View in Genome Browser
Species Human (GRCh38)
Location 20:55698520-55698542
Sequence TCTTAGATTCAGAGGGTACA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1175007282_1175007285 26 Left 1175007282 20:55698471-55698493 CCGGAAATATGATTGTGACTACA No data
Right 1175007285 20:55698520-55698542 TCTTAGATTCAGAGGGTACATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1175007285 Original CRISPR TCTTAGATTCAGAGGGTACA TGG Intergenic
No off target data available for this crispr