ID: 1175014557

View in Genome Browser
Species Human (GRCh38)
Location 20:55775341-55775363
Sequence TAAGATAAGCATCAGGAGGA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1175014557_1175014560 -4 Left 1175014557 20:55775341-55775363 CCATCCTCCTGATGCTTATCTTA No data
Right 1175014560 20:55775360-55775382 CTTAGATAAAAATTCTGAAATGG No data
1175014557_1175014562 6 Left 1175014557 20:55775341-55775363 CCATCCTCCTGATGCTTATCTTA No data
Right 1175014562 20:55775370-55775392 AATTCTGAAATGGGTCAAGCAGG No data
1175014557_1175014561 -3 Left 1175014557 20:55775341-55775363 CCATCCTCCTGATGCTTATCTTA No data
Right 1175014561 20:55775361-55775383 TTAGATAAAAATTCTGAAATGGG No data
1175014557_1175014563 16 Left 1175014557 20:55775341-55775363 CCATCCTCCTGATGCTTATCTTA No data
Right 1175014563 20:55775380-55775402 TGGGTCAAGCAGGCCCAGCTCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1175014557 Original CRISPR TAAGATAAGCATCAGGAGGA TGG (reversed) Intergenic
No off target data available for this crispr