ID: 1175023209

View in Genome Browser
Species Human (GRCh38)
Location 20:55873535-55873557
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1175023209_1175023213 15 Left 1175023209 20:55873535-55873557 CCAGCTTTCAGGCTGCAGGTCCA No data
Right 1175023213 20:55873573-55873595 TTTCTCCCTTGCCAGCGCCCAGG No data
1175023209_1175023219 26 Left 1175023209 20:55873535-55873557 CCAGCTTTCAGGCTGCAGGTCCA No data
Right 1175023219 20:55873584-55873606 CCAGCGCCCAGGATTCCATGGGG No data
1175023209_1175023217 25 Left 1175023209 20:55873535-55873557 CCAGCTTTCAGGCTGCAGGTCCA No data
Right 1175023217 20:55873583-55873605 GCCAGCGCCCAGGATTCCATGGG No data
1175023209_1175023216 24 Left 1175023209 20:55873535-55873557 CCAGCTTTCAGGCTGCAGGTCCA No data
Right 1175023216 20:55873582-55873604 TGCCAGCGCCCAGGATTCCATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1175023209 Original CRISPR TGGACCTGCAGCCTGAAAGC TGG (reversed) Intergenic