ID: 1175023212

View in Genome Browser
Species Human (GRCh38)
Location 20:55873563-55873585
Sequence GGCAAGGGAGAAAATTCACC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1175023212_1175023217 -3 Left 1175023212 20:55873563-55873585 CCAGGTGAATTTTCTCCCTTGCC No data
Right 1175023217 20:55873583-55873605 GCCAGCGCCCAGGATTCCATGGG No data
1175023212_1175023216 -4 Left 1175023212 20:55873563-55873585 CCAGGTGAATTTTCTCCCTTGCC No data
Right 1175023216 20:55873582-55873604 TGCCAGCGCCCAGGATTCCATGG No data
1175023212_1175023219 -2 Left 1175023212 20:55873563-55873585 CCAGGTGAATTTTCTCCCTTGCC No data
Right 1175023219 20:55873584-55873606 CCAGCGCCCAGGATTCCATGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1175023212 Original CRISPR GGCAAGGGAGAAAATTCACC TGG (reversed) Intergenic