ID: 1175023213

View in Genome Browser
Species Human (GRCh38)
Location 20:55873573-55873595
Sequence TTTCTCCCTTGCCAGCGCCC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1175023208_1175023213 16 Left 1175023208 20:55873534-55873556 CCCAGCTTTCAGGCTGCAGGTCC No data
Right 1175023213 20:55873573-55873595 TTTCTCCCTTGCCAGCGCCCAGG No data
1175023211_1175023213 -5 Left 1175023211 20:55873555-55873577 CCACAAGTCCAGGTGAATTTTCT No data
Right 1175023213 20:55873573-55873595 TTTCTCCCTTGCCAGCGCCCAGG No data
1175023209_1175023213 15 Left 1175023209 20:55873535-55873557 CCAGCTTTCAGGCTGCAGGTCCA No data
Right 1175023213 20:55873573-55873595 TTTCTCCCTTGCCAGCGCCCAGG No data
1175023206_1175023213 25 Left 1175023206 20:55873525-55873547 CCACGTCTGCCCAGCTTTCAGGC 0: 1
1: 0
2: 0
3: 13
4: 162
Right 1175023213 20:55873573-55873595 TTTCTCCCTTGCCAGCGCCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1175023213 Original CRISPR TTTCTCCCTTGCCAGCGCCC AGG Intergenic