ID: 1175023216

View in Genome Browser
Species Human (GRCh38)
Location 20:55873582-55873604
Sequence TGCCAGCGCCCAGGATTCCA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1175023209_1175023216 24 Left 1175023209 20:55873535-55873557 CCAGCTTTCAGGCTGCAGGTCCA No data
Right 1175023216 20:55873582-55873604 TGCCAGCGCCCAGGATTCCATGG No data
1175023208_1175023216 25 Left 1175023208 20:55873534-55873556 CCCAGCTTTCAGGCTGCAGGTCC No data
Right 1175023216 20:55873582-55873604 TGCCAGCGCCCAGGATTCCATGG No data
1175023211_1175023216 4 Left 1175023211 20:55873555-55873577 CCACAAGTCCAGGTGAATTTTCT No data
Right 1175023216 20:55873582-55873604 TGCCAGCGCCCAGGATTCCATGG No data
1175023212_1175023216 -4 Left 1175023212 20:55873563-55873585 CCAGGTGAATTTTCTCCCTTGCC No data
Right 1175023216 20:55873582-55873604 TGCCAGCGCCCAGGATTCCATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1175023216 Original CRISPR TGCCAGCGCCCAGGATTCCA TGG Intergenic