ID: 1175024193

View in Genome Browser
Species Human (GRCh38)
Location 20:55884167-55884189
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1175024188_1175024193 30 Left 1175024188 20:55884114-55884136 CCTTAATGAATAGGAGAAGTGTC No data
Right 1175024193 20:55884167-55884189 CTGTTTCAGTACATGTATAGAGG No data
1175024189_1175024193 8 Left 1175024189 20:55884136-55884158 CCTTATAAGAAGAAGAAAAGACC No data
Right 1175024193 20:55884167-55884189 CTGTTTCAGTACATGTATAGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1175024193 Original CRISPR CTGTTTCAGTACATGTATAG AGG Intergenic
No off target data available for this crispr