ID: 1175027601

View in Genome Browser
Species Human (GRCh38)
Location 20:55919103-55919125
Sequence CTATATGGTCAGAAAAGGGG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1175027591_1175027601 29 Left 1175027591 20:55919051-55919073 CCATCAGTGCCATGACAGTTTAC 0: 25
1: 256
2: 695
3: 898
4: 789
Right 1175027601 20:55919103-55919125 CTATATGGTCAGAAAAGGGGAGG No data
1175027590_1175027601 30 Left 1175027590 20:55919050-55919072 CCCATCAGTGCCATGACAGTTTA 0: 28
1: 280
2: 699
3: 948
4: 818
Right 1175027601 20:55919103-55919125 CTATATGGTCAGAAAAGGGGAGG No data
1175027592_1175027601 20 Left 1175027592 20:55919060-55919082 CCATGACAGTTTACAAATGTCAT 0: 51
1: 884
2: 952
3: 753
4: 796
Right 1175027601 20:55919103-55919125 CTATATGGTCAGAAAAGGGGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1175027601 Original CRISPR CTATATGGTCAGAAAAGGGG AGG Intergenic
No off target data available for this crispr